Identification of the Bacterial Leaf Spot Pathogen of Poinsettia in China

Abstract

Bacterial leaf spot of poinsettia has been first reported in China in 2003 and ascribed to Xanthomonas campestris pv. poinsettiicola following the traditional classification of xanthomonads. The present study was undertaken to elucidate the precise position of the causal bacterium in the newly proposed classification of xanthomonads, three bacterial isolates from China were compared with all known Xanthomonas type strains by a polyphasic approach including carbon source utilization profile, fatty acid methyl esters, analysis of 16S rRNA gene sequence and 16S-23S rDNA intergenic spacer sequences. The results indicated that these Chinese isolates could be further identified as a pathovar of Xanthomonas axonopodis.

Reclassification of Xanthomonas Isolates Causing Bacterial Leaf Spot of Euphorbia pulcherrima

“…poinsettiicola, respectively. However, in this study, the BLSE isolates from China and India was unable to be differentiated from X. codiaei LMG 8678 T , which may explain the result that the BLSE isolates from Hainan province, China had higher similarity with the type strain of X. codiaei than the type strains of other Xanthomonas species based on sequences analysis of the 16S-23S ITS regions (Li et al, 2008b).…”

“…Sequencing of 16S rRNA genes, 16S-23S ITS regions and gyrB gene. Total DNAs of the BLSE isolates in this study were extracted by the CTAB (Cetyltrimethylammonium Bromide) method (Li et al, 2006b). Amplification of the partial 16S rRNA genes of the BLSE isolates from India and New Zealand was performed by PCR as described by Hauben et al (1997) using the specific primers 16F27 (AGAGTTTGATCCTGGCTCAG) and 16R1522 (AAGG-AGGTGATCCAGCCGCA), while amplification of the 16S-23S ITS regions of the BLSE isolates from India and New Zealand was carried out by PCR as described by Goncalves and Rosato (2002) using the specific primers 16S uni 1330 (5'-GTTCCCGGGCCTTGTACACAC-3') and 23S uni 322 anti (5'-GGTTCTTTTCACCTTTCCCTC-3').…”

“…The sequencing was performed with an ABI 3730 automatic sequencer (Bioasia, Shanghai, China). In addition, the 16S rRNA genes and the 16S-23S ITS regions of the BLSE isolates from USA and China have been sequenced in previous studies (Goncalves and Rosato, 2002;Hauben et al, 1997;Li et al, 2006bLi et al, , 2008b.…”

“…poinsettiicola, has been reported in some countries in Oceania, Asia, the Americas and Europe (Li et al, 2006b;Stravato, 2004). In China, this disease has been observed on E. pulcherrima in Zhejiang province (Li et al, 2005(Li et al, , 2006a(Li et al, , 2008a and Hainan province (Li et al, 2008b). However, the BLSE isolates from India, USA and New Zealand showed differential pathogenicity reaction on Codiacum variegatum and metabolization of quinate (Vauterin et al, 1995).…”

“…poinsettiicola (Vauterin et al, 1995. In addition, the Chinese isolates from Zhejiang province and Hainan province showed higher similarity with the type strain of X. axonopodis (Li et al, 2006b) and X. codiaei (Li et al, 2008b) than the type strains of other Xanthomonas species, respectively, based on sequences analysis of the 16S rRNA gene and the 16S-23S rDNA intergenic spacer (ITS). However, there is little research about the relationship between the Chinese isolates and the BLSE isolates from India, USA and New Zealand.…”