Identification of Host Genes Involved in Geminivirus Infection Using a Reverse Genetics Approach

Abstract

Geminiviruses, like all viruses, rely on the host cell machinery to establish a successful infection, but the identity and function of these required host proteins remain largely unknown. Tomato yellow leaf curl Sardinia virus (TYLCSV), a monopartite geminivirus, is one of the causal agents of the devastating Tomato yellow leaf curl disease (TYLCD). The transgenic 2IRGFP N. benthamiana plants, used in combination with Virus Induced Gene Silencing (VIGS), entail an important potential as a tool in reverse genetics studies to identify host factors involved in TYLCSV infection. Using these transgenic plants, we have made an accurate description of the evolution of TYLCSV replication in the host in both space and time. Moreover, we have determined that TYLCSV and Tobacco rattle virus (TRV) do not dramatically influence each other when co-infected in N. benthamiana, what makes the use of TRV-induced gene silencing in combination with TYLCSV for reverse genetic studies feasible. Finally, we have tested the effect of silencing candidate host genes on TYLCSV infection, identifying eighteen genes potentially involved in this process, fifteen of which had never been implicated in geminiviral infections before. Seven of the analyzed genes have a potential anti-viral effect, whereas the expression of the other eleven is required for a full infection. Interestingly, almost half of the genes altering TYLCSV infection play a role in postranslational modifications. Therefore, our results provide new insights into the molecular mechanisms underlying geminivirus infections, and at the same time reveal the 2IRGFP/VIGS system as a powerful tool for functional reverse genetics studies.

Ubiquitin and Plant Viruses, Let’s Play Together!

“…Information from genome-wide genetic or proteomic screens (Kushner et al, 2003;Panavas et al, 2005;Serviene et al, 2006;Li et al, 2008;Gancarz et al, 2011;Lozano-Durán et al, 2011b) supports the idea that ubiquitination of viral proteins is important for viral multiplication. Direct demonstration of Ub conjugation of viral proteins has also been reported in a few cases (described further below; Table II).…”

No evidence of seed transmissibility of Tomato yellow leaf curl virus in Nicotiana benthamiana

“…1). Symptom evaluation correlated with TYLCV accumulation, as measured by quantitative PCR (qPCR) with primers to quantify the TYLCV Rep gene (TGAGAACGTCGTGTCTT CCG and TGACGTTGTACCACGCATCA) and 25S ribosomal DNA interspacer (ITS) as the normalizer (ATAACCGCATCAGGTCTCCA and CCGAAGTT ACGGATCCATTT) (Lozano-Durán et al, 2011). As shown in Fig.…”

SnRK1 Phosphorylation of AL2 Delays Cabbage Leaf Curl Virus Infection in Arabidopsis

“…An Arabidopsis thaliana TIFY family transcription factor, PEAPOD2, has been shown to interact with the AL2 proteins and the CP promoters of Tomato golden mosaic virus (TGMV) and Cabbage leaf curl virus (CaLCuV) (13). Another candidate AL2/C2 partner is the JDK transcription factor (14). Because CP and NSP are required for the trafficking of viral DNAs or virions through the nuclear membrane, begomovirus AL2/C2 proteins play an important role in viral movement and the spread of infection.…”