Identification of bacteria from the normal flora of perch, <i>Perca fluviatilis</i> L., and evaluation of their inhibitory potential towards <i>Aeromonas</i> species

Goldschmidt-Clermont, Elinor; Wahli, Thomas; Frey, Joachim; Burr, Sarah E.

doi:10.1111/j.1365-2761.2008.00912.x

Cited by 25 publications

(18 citation statements)

References 29 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Bacteria from the skin flora may play a role in development of the disease, and some microorganisms could protect against Saprolegnia parasitica infection on fish (Petersen et al 1994). Therefore, studying the local flora where the infection is established is likely to yield bacterial isolates potentially useful for biocontrol, as has been done with various other fish and amphibian infections (Spanggaard et al 2001, Silva et al 2005, Harris et al 2006, Goldschmidt-Clermont et al 2008, Aly et al 2008, Fjellheim et al 2010). …”

Section: Introductionmentioning

confidence: 99%

Bacterial skin flora variation and in vitro inhibitory activity against Saprolegnia parasitica in brown and rainbow trout

et al. 2011

View full text Add to dashboard Cite

Variations in the number and diversity of bacteria from the skin of brown trout Salmo trutta L. and rainbow trout Oncorhynchus mykiss Walbaum were surveyed from different rivers and fish farms in northern Spain. In addition to determining bacterial populations in skin samples of healthy fish, bacterial populations were determined from skin lesions (of brown trout only) infected with Saprolegnia parasitica, the causal agent of saprolegniosis. Mean bacterial counts from skin lesions of brown trout suffering from saprolegniosis were nearly 1000 times greater than from the skin of uninfected brown and rainbow trout. More than 20 different genera of bacteria were identified, with isolates of Aeromonas and Iodobacter being the predominant genera associated with saprolegniosis lesions. The in vitro inhibitory activity of 72 of these skin isolates was tested against S. parasitica using 3 different assays. These included (1) assessing the inhibition by bacteria of colony growth on agar media, (2) the inhibition of colony growth from colonized hemp seeds in liquid media and (3) the inhibition of cyst germination in liquid media. Finally, the fungicidal effect of the 24 most inhibitory bacterial species, and the inhibitory activity of their culture supernatants, was tested in the same way. Isolates identified as Aeromonas piscicola, A. sobria, Pantoea agglomerans and Pseudomonas fluorescens achieved the highest inhibition against S. parasitica. Many of these inhibitory isolates were obtained primarily from skin lesions of fish with saprolegniosis. It is suggested that some of these isolates might be useful in the biological control of saprolegniosis. KEY WORDS: Saprolegnia parasitica · Inhibition assays · Bacterial skin flora · TroutResale or republication not permitted without written consent of the publisher Dis Aquat Org 96: 125-135, 2011 However, the selection of bacteria useful for biocontrol is a laborious task based on in vitro and in vivo tests on a large set of bacteria. In vitro tests, which are used as primary screening, usually comprise several independent tests, which means that they are focused on the demonstration of different bacterial properties. In the case of bacteria for control of Saprolegnia spp., inhibition of myce lium growth and cyst germination (Hatai & Willoug hby 1988, Bly et al. 1997, Hussein & Hatai 2001, Lategan & Gibson 2003, Zhang et al. 2008, the ability to kill the organism and the capacity to attach to the mucus of fish are theoretically advantageous features. Studying production of extracellular substances by inhibitory bacteria would add information about their mechanism of action and might make it possible to isolate the inhibitory substance for management of fish health (Lategan et al. 2006). In vivo tests, used as secondary screening, are crucial in determining whether the bacteria are effective in the biocontrol of saprolegniosis (Lategan & Gibson 2003, Lategan et al. 2004.The aim of the present work was to determine the in vitro inhibitory activity of bacteria found ...

show abstract

Section: Introductionmentioning

confidence: 99%

Bacterial skin flora variation and in vitro inhibitory activity against Saprolegnia parasitica in brown and rainbow trout

et al. 2011

View full text Add to dashboard Cite

show abstract

“…All strains were identified by sequence analysis of a 1.3‐kb fragment of the 16SrRNA ( rrs ) gene amplified with primers 16SUNI‐L (AGAGTTTGATCATGGCTCAG) and 16SUNI‐R (GTGTGACGGGCGGTGTGTAC) as previously described (Kuhnert et al. 2002; Goldschmidt‐Clermont et al. 2008).…”

Section: Origin Identification and Phenotypic Properties Of Aeromonmentioning

confidence: 91%

“…2005). A subsequent study, however, found A. sobria and A. veronii were among the dominant members of the intestinal microbiota of wild perch caught in the same lake and presenting no signs of disease (Goldschmidt‐Clermont et al. 2008).…”

Section: Origin Identification and Phenotypic Properties Of Aeromonmentioning

confidence: 99%

See 1 more Smart Citation

Heterogeneity of Aeromonas populations in wild and farmed perch, Perca fluviatilis L.

Burr

Goldschmidt-Clermont

Kuhnert

et al. 2012

Journal of Fish Diseases

Self Cite

View full text Add to dashboard Cite

“…In a recent study, a Pseudomonas chlororaphis strain, isolated from the intestine of perch, Perca fluviatilis L., was suggested as a potential probiotic to prevent infection by Aeromonas sobria (Goldschmidt‐Clermont, Wahli, Frey & Burr 2008). Aeromonas sobria , which is a cause of motile aeromonad septicaemia, has been identified as the source of significant mortalities in farmed perch in Switzerland (Wahli, Burr, Pugovkin, Mueller & Frey 2005).…”

Section: Introductionmentioning

confidence: 99%

Pseudomonas chlororaphis strain JF3835 reduces mortality of juvenile perch, Perca fluviatilis L., caused by Aeromonas sobria

Gobeli

Goldschmidt-Clermont

Frey

et al. 2009

Journal of Fish Diseases

Self Cite

View full text Add to dashboard Cite

Motile aeromonad septicaemia caused by Aeromonas sobria is a cause of disease in farmed perch, Perca fluviatilis L., in Switzerland. We have evaluated the potential of a Pseudomonas chlororaphis isolate, obtained from perch intestine, to control A. sobria infection. Inoculation of juvenile perch with P. chlororaphis strain JF3835 prior to infection with A. sobria caused a reduction in A. sobria associated mortalities. Infection of perch with xylE-labelled P. chlororaphis indicated the bacterium is able to transiently colonize juvenile fish and fingerlings.

show abstract

Identification of bacteria from the normal flora of perch, Perca fluviatilis L., and evaluation of their inhibitory potential towards Aeromonas species

Cited by 25 publications

References 29 publications

Bacterial skin flora variation and in vitro inhibitory activity against Saprolegnia parasitica in brown and rainbow trout

Bacterial skin flora variation and in vitro inhibitory activity against Saprolegnia parasitica in brown and rainbow trout

Heterogeneity of Aeromonas populations in wild and farmed perch, Perca fluviatilis L.

Pseudomonas chlororaphis strain JF3835 reduces mortality of juvenile perch, Perca fluviatilis L., caused by Aeromonas sobria

Contact Info

Product

Resources

About