Identification of Achromobacter xylosoxidans by detection of the blaOXA-114-like gene intrinsic in this species

Turton, Jane F.; Mustafa, Nazim; Shah, Jayesh; Hampton, Catherine V.; Pike, Rachel; Kenna, D.

doi:10.1016/j.diagmicrobio.2011.02.007

Cited by 29 publications

(43 citation statements)

References 10 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Two small single-center studies found that all patients were infected with unique Achromobacter strains (20,21). Conversely, several studies (both single and multicenter) have suggested that shared strains do exist (2,12,18,19,24,25,27,33,(43)(44)(45)(46)(47)(48), with common strains accounting for 5 to 50% of total Achromobacter infections. Additionally, chronic infection was most commonly due to persistence of the original infecting strain (14,19,45).…”

Section: Discussionmentioning

confidence: 99%

Prevalence and Outcomes of Achromobacter Species Infections in Adults with Cystic Fibrosis: a North American Cohort Study

et al. 2017

View full text Add to dashboard Cite

Achromobacter species are increasingly being detected in cystic fibrosis (CF) patients, with an unclear epidemiology and impact. We studied a cohort of patients attending a Canadian adult CF clinic who had positive sputum cultures for Achromobacter species in the period from 1984 to 2013. Infection was categorized as transient or persistent (Ն50% positive cultures for 1 year). Those with persistent infection were matched 2:1 with age-, sex-, and time-matched controls without a history of Achromobacter infection, and mixed-effects models were used to assess pulmonary exacerbation (PEx) frequency and lung function decline. Isolates from a biobank were retrospectively assessed, identified to the species level by nrdA sequencing, and genotyped using pulsed-field gel electrophoresis (PFGE). Thirty-four patients (11% of those in our clinic), with a median age of 24 years (interquartile range [IQR], 20.3 to 29.8 years), developed Achromobacter infection. Ten patients (29%) developed persistent infection. Persistence did not denote permanence, as most patients ultimately cleared infection, often after years. Patients were more likely to experience PEx at incident isolation than at prior or subsequent visits (odds ratio [OR], 2.7 [95% confidence interval {CI}, 1.2 to 6.7]; P ϭ 0.03). Following persistent infection, there was no difference in annual lung function decline (Ϫ1.08% [95% CI, Ϫ2.73 to 0.57%] versus Ϫ2.74% [95% CI, Ϫ4.02 to 1.46%]; P ϭ 0.12) or the odds of PEx (OR, 1.21 [95% CI, 0.45 to 3.28]; P ϭ 0.70). Differential virulence among Achromobacter species was not observed, and no cases of transmission occurred. We demonstrated that incident Achromobacter infection was associated with a greater risk of PEx; however, neither transient nor chronic infection was associated with a worsened long-term prognosis. Large, multicenter studies are needed to clarify the clinical impact, natural history, and transmissibility of Achromobacter.

show abstract

Section: Discussionmentioning

confidence: 99%

Prevalence and Outcomes of Achromobacter Species Infections in Adults with Cystic Fibrosis: a North American Cohort Study

et al. 2017

View full text Add to dashboard Cite

show abstract

“…The presence of the A. xylosoxidans species-specific marker bla OXA-114 was investigated by PCR amplification as described by Turton et al (15) with positive amplification in all isolates. Purified amplicons were sequenced in both strands as described above, and the nucleotide sequences were compared with those of all the different bla OXA-114 allelic variants deposited in GenBank.…”

mentioning

confidence: 99%

OXA-258 from Achromobacter ruhlandii: a Species-Specific Marker

et al. 2013

View full text Add to dashboard Cite

A new bla OXA-258 gene is described as a species-specific taxonomic marker for Achromobacter ruhlandii isolates (all recovered from cystic fibrosis patients). Even though OXA-258 differs from OXA-114 variants, isolates could be misidentified as A. xiloxosidans by the amplification of an inner fragment from the OXA-coding gene. A robust identification of A. ruhlandii can be achieved by sequencing this single OXA gene, as well as by a more laborious recently proposed multilocus sequence-typing (MLST) scheme.

show abstract

“…Последовательность праймера (5'→3') Название гена Ссылка gltB_Bcc_F CTGCATCATGATGCGCAAGT Большой субъединицы глутамат синтазы [6] gltB_Bcc_R CTTGCCGCGGAARTCGTTGG nrdA_P1 GAACTGGATTCCCGACCTGTTC Альфа-субъединицы рибонуклеозид-ди-фосфат редуктазы [3] nrdA_P2 TTCGATTTGACGTACAAGTTCTGG OXA-114F2 CGCATCCTGTTCCAGCA Оксациллиназы (bla-OXA) [5] OXA-114R2 GTGCCGGTCTTGCCATAC…”

Section: название праймераunclassified

“…2). Виды A. xylosoxidans и A. marplatensis не различимы по этой мишени, представители видов A. dolens, A. ruhlandii имеют свои характерные алле-ли, для малочисленных пока штаммов A. pulmonis ген bla-OXA с праймерами [5] детектировать не уда-ется. Возможно, у представителей данного вида ген bla-OXA отсутствует.…”

Section: результаты и обсуждениеunclassified

“…[4]. В видовой идентификации хорошо зарекомендовал себя ген оксациллиназы bla-OXA, характерный для большинства представи-телей этого рода, отличающихся резистентностью к β-лактамам [5]. Протестировав все три перечис-ленных подхода к генотипированию на расширен-ной выборке образцов от пациентов и штаммов, мы пришли к заключению о возможности сокраще-ния мишеней в идентификации Achromobacter spp.…”

unclassified

See 1 more Smart Citation

Express-genotyping of Achromobacter spp. in biological samples

Voronina¹,

Kunda²,

Рыжова³

et al. 2015

Lab. sluzh.

View full text Add to dashboard Cite

bacter) -грамотрицательный неферментирующий микроорганизм, вызывающий внутрибольничные инфекции. Обнаружен в крови, спинальной, пери-тонеальной и плевральной жидкостях, гное, моче, мазках из глаза, уха, зева, нестерильной дистил-лированной воде и растворах хлоргексидина [1]. Achromobacter spp. сложно идентифицировать с по-мощью фенотипических методов, особенно в ран-них (48 ч) культурах. Возможна ложная идентифи-кация как Bordetella, Pseudomonas, Burkholderia. В на-стоящее время род Achromobacter насчитывает 16 ви-дов. Дополнительно выделяют геногруппы 1,3,8,9, 12, 13, 16, 17, 18, 19, 20, не оформленные как виды. Метод масс-спектрометрии (MicroFlex, «Bruker», Германия) идентифицирует представителей только некоторых видов Achromobacter spp. и, преимуще-ственно, как A. xylosoxidans. Таким образом, видо-вая идентификация возможна только с помощью молекулярно-генетических методов. В молекуляр-но-эпидемиологическом анализе хорошо зареко-мендовал себя метод мультилокусного секвениро- Achromobacter spp. -условно-патогенный микроорганизм, вызывающий внутрибольничные инфекции, особенно опас-ный для пациентов отделений реанимации и интенсивной терапии и пульмонологии. микроорганизм сложен в иденти-фикации методами классической микробиологии и масс-спектрометрии. целью данного исследования была разработка схемы экспресс-генотипирования с помощью молекулярно-генетических методов, позволяющей на основе минимального количества мишеней идентифицировать вид и генотип Achromobacter spp. исследование выполнено на биологических образцах от пациентов, у которых ранее нами был определен Achromobacter spp. использован метод мультилокусного секвенирования (multi locus sequence typing, mlst), дополненный необходимыми для дифференциальной диагностики мишенями. результатом работы является протокол экспресс-генотипирования Achromobacter spp., включающий выделе-ние ДНК из биологического образца, амплификацию и секвенирование трех генов: gltB, nrdA765 и bla-OXA с последу-ющим определением вида и генотипа микроорганизма. Применение протокола позволяет сократить время и расходы на идентификацию Achromobacter spp. и по результатам анализа своевременно изолировать пациентов, инфицированных эпидемически значимыми штаммами ахромобактера. Ключевые слова: Achromobacter spp., мультилокусное секвенирование, генотипирование, экспресс-диагностика.Achromobacter spp. -opportunistic microorganism, causing nosocomial infections, which are especially dangerous for the patients from the departments of the reanimation and intensive therapy and pulmonology. this microorganism is very complicated in the identification by classical microbiological methods and by mass-spectrometry. the aim of this investigation was the development of the express-genotyping scheme with help of the molecular-genetic methods. this scheme allows to identify the species and the genotype of Achromobacter spp. on the base of the minimal targets number. the investigation was made on the biological samples from the patients, who were detected earlier in our research as infected by Achrom...

show abstract

Identification of Achromobacter xylosoxidans by detection of the blaOXA-114-like gene intrinsic in this species

Cited by 29 publications

References 10 publications

Prevalence and Outcomes of Achromobacter Species Infections in Adults with Cystic Fibrosis: a North American Cohort Study

Prevalence and Outcomes of Achromobacter Species Infections in Adults with Cystic Fibrosis: a North American Cohort Study

OXA-258 from Achromobacter ruhlandii: a Species-Specific Marker

Express-genotyping of Achromobacter spp. in biological samples

Contact Info

Product

Resources

About