Identification of a novel Staphylococcus pseudintermedius exfoliative toxin gene and its prevalence in isolates from canines with pyoderma and healthy dogs

Iyori, Keita; Hisatsune, Junzo; Kawakami, Tetsuji; Shibata, Sanae; Murayama, Nobuo; Ide, Kaori; Nagata, Masahiko; Fukata, Tsuneo; Iwasaki, Tadaaki; Oshima, Koichiro; Hattori, Masahira; Sugai, Motoyuki; Nishifuji, Koji

doi:10.1111/j.1574-6968.2010.02113.x

Cited by 46 publications

(45 citation statements)

References 30 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…46.6% (Lautz et al 2006), but almost equal to the percentage reported by Yoon et al (2010). The occurrence of the exi gene (22.8%) was similar to that observed by FutagawaSaito et al (2009) and the prevalence of the expB gene (7.6%) was lower than the 23% indicated by Iyori et al (2010). The prevalence of the enterotoxinrelated gene sec canine (16.5%) was close to the 12.6% reported by Becker et al (2001) but lower than the 24% described by Yoon et al (2010) and other authors who confirmed its presence in all tested isolates (Futagawa-Saito et al 2004).…”

Section: Discussionsupporting

confidence: 82%

Characterisation of methicillin-susceptible Staphylococcus pseudintermedius isolates from canine infections and determination of virulence factors using multiplex PCR

Melter¹,

Švec²,

Tkadlec³

et al. 2017

Vet. Med. - Czech

View full text Add to dashboard Cite

ABSTRACT:Staphylococcus pseudintermedius is a genuine opportunistic pathogen of the skin, especially in canids. However, characterisation of virulence, antimicrobial resistance and genotypic variability in methicillin-susceptible S. pseudintermedius isolates has not been fully explored. In this study, coagulase-positive staphylococcal isolates collected from dogs of various breeds and ages suffering from dermatitis (n = 70), pyoderma (n = 7), and otitis (n = 7), from districts of Prague (Czech Republic) and surrounding areas, were characterised using matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry, and repetitive sequence-based PCR fingerprinting. Susceptibility to antimicrobial agents was determined, virulence factor genes for leukocidin (lukSF-I), exfoliatins (exi, expB, and siet), enterotoxin C (sec canine ) and enterotoxin-related genes (se-int and sel) were detected using multiplex PCR and the genotypes of S. pseudintermedius isolates were determined using SmaI macrorestriction analysis. The majority of the staphylococcal isolates (n = 84) were identified as S. pseudintermedius (n = 79) and all of them were susceptible to methicillin/oxacillin (MSSP). About half of the strains (n = 41) were resistant to macrolide-lincosamide-streptogramin B antimicrobial agents and resistance was mediated in all but one of the strains by the erm(B) gene. The genes for lukSF-I, siet, se-int, and sel were detected in the majority of the MSSP strains (96.2%, 100%, 100%, and 73.4%, respectively). Investigated canine S. pseudintermedius isolates were highly heterogeneous, which prevented the correlation of any specific lineage to a particular infection, dog breed, or region of origin. Keywords: Staphylococcus pseudintermedius; macrolide lincosamide-streptogramin B (MLS B ) resistance; genotyping; virulence genesStaphylococcus pseudintermedius, a pathogen that infects dogs, is comparable to Stapylococcus aureus in humans. This analogy fits not only the phenotypic characteristics (e.g. similar colony morphology, pigment, haemolysis), but is also supported by the striking similarity in ecology/epidemiology (colonisation or infection of the skin and skin adnexa, vertical/horizontal transmission), expression of homologous virulence factors (cell wall-anchored proteins such as microbial surface components recognising adhesive matrix molecules; protein A; and enzymes, e.g. coagulase; secreted toxins, such as cytotoxins, exfoliative toxins, or superantigens) and pathogenicity (skin infections or invasive infections). These two coagulase-positive species probably evolved separately through adaptation

show abstract

Section: Discussionsupporting

confidence: 82%

Characterisation of methicillin-susceptible Staphylococcus pseudintermedius isolates from canine infections and determination of virulence factors using multiplex PCR

Melter¹,

Švec²,

Tkadlec³

et al. 2017

Vet. Med. - Czech

View full text Add to dashboard Cite

show abstract

“…1). Regarding the exfoliative toxins in MSSP reported on here, one human isolate yielded a positive PCR result for ExpA, while two canine strains were found positive for ExpB, indicating that these virulence factors may be more frequently associated with cases of superficial dermatitis in dogs [32], [33].…”

Section: Discussionmentioning

confidence: 56%

“…The presence of the exfoliative toxin ExpA (formerly named EXI) was determined by PCR with the primers exp A-F GCGCGTCCTTCTGATCCAGAACT and exp A-R AACGTCCCCCTTTACCTACGTGAAT (according to AB489850.1, [32] at an annealing temperature of 58°C (25 cycles) including strain IMT21652 (JN604832) as a positive control. Detection of the gene encoding ExpB was performed as described previously [33].…”

Section: Methodsmentioning

confidence: 99%

Sharing More than Friendship — Nasal Colonization with Coagulase-Positive Staphylococci (CPS) and Co-Habitation Aspects of Dogs and Their Owners

et al. 2012

View full text Add to dashboard Cite

BackgroundSince the relationship between dogs and their owners has changed, and dogs moved from being working dogs to family members in post-industrial countries, we hypothesized that zoonotic transmission of opportunistic pathogens like coagulase positive staphylococci (CPS) is likely between dogs and their owners.Methodology/Principal FindingsCPS- nasal carriage, different aspects of human-to-dog relationship as well as potential interspecies transmission risk factors were investigated by offering nasal swabs and a questionnaire to dog owners (108) and their dogs (108) at a dog show in 2009. S. aureus was found in swabs of 20 (18.5%) humans and two dogs (1.8%), and spa types which correspond to well known human S. aureus lineages dominated (e.g. CC45, CC30 and CC22). Multilocus sequence typing (MLST) of the two canine strains revealed ST72 and ST2065 (single locus variant of ST34). Fifteen dogs (13.9%) and six owners (5.6%) harboured S. pseudintermedius, including one mecA-positive human isolate (MRSP). Pulsed field gel electrophoresis (PFGE) revealed that one dog/owner pair harboured indistinguishable S. pseudintermedius- isolates of ST33. Ten (48%) of the 21 S. pseudintermedius-isolates showed resistance towards more than one antimicrobial class. 88.9% of the dog owners reported to allow at least one dog into the house, 68.5% allow the dog(s) to rest on the sofa, 39.8% allow their dogs to come onto the bed, 93.5% let them lick their hands and 52.8% let them lick their face. Bivariate analysis of putative risk factors revealed that dog owners who keep more than two dogs have a significantly higher chance of being colonized with S. pseudintermedius than those who keep 1–2 dogs (p<0.05).Conclusions/RecommendationsIn conclusion, CPS transmission between dog owners and their dogs is possible. Further investigation regarding interspecies transmission and the diverse adaptive pathways influencing the epidemiology of CPS (including MRSA and MRSP) in different hosts is needed.

show abstract

“…The authors proposed the renaming of EXI as EXPA (exfoliatin of S. pseudintermedius type A), and the novel protein was named EXPB (exfoliatin of S. pseudintermedius type B). Moreover, it was shown that both EXPA and EXPB could digest canine desmoglein-1 (Dsg-1) and caused subcorneal splits in the epidermis when injected in mice, which resembles mechanisms involved in the pathogenesis of intraepidermal splitting in canine impetigo (46,47).…”

Section: Staphylococcus Pseudintermediusmentioning

confidence: 99%

Staphylococcus pseudintermedius, both commensal and pathogen

Chrobak-Chmiel¹,

Golke²,

Dembele³

et al. 2018

Medycyna Weterynaryjna

View full text Add to dashboard Cite

Staphylococcus pseudintermedius is considered to be a both commensal and opportunistic canine pathogen. The anal, perineal and nasal locations appear to be the main S. pseudintermedius colonization sites, from which bacteria are transmitted to other body sites, causing secondary infections. When the immune system is compromised because of an underlying condition, the skin becomes susceptible to infection. Thus, the host’s condition seems to play a crucial role in the pathogenesis of S. pseudintermedius infections. There are some predisposing factors, one of which is atopic dermatitis. The pathogenic effects of S. pseudintermedius are mediated by several virulence factors, for instance superantigens, which play an important role by causing dermatitis. The immune system has evolved many different mechanisms to recognize and deal with pathogens, but bacteria have also developed various strategies to evade them. In this review, we focus on early stages of the innate immune response with particular emphasis on the mechanisms of recognition of staphylococci and the action of antimicrobial peptides. .

show abstract

Identification of a novel Staphylococcus pseudintermedius exfoliative toxin gene and its prevalence in isolates from canines with pyoderma and healthy dogs

Cited by 46 publications

References 30 publications

Characterisation of methicillin-susceptible Staphylococcus pseudintermedius isolates from canine infections and determination of virulence factors using multiplex PCR

Characterisation of methicillin-susceptible Staphylococcus pseudintermedius isolates from canine infections and determination of virulence factors using multiplex PCR

Sharing More than Friendship — Nasal Colonization with Coagulase-Positive Staphylococci (CPS) and Co-Habitation Aspects of Dogs and Their Owners

Staphylococcus pseudintermedius, both commensal and pathogen

Contact Info

Product

Resources

About