Vagococcus salmoninarum I—A chronic coldwater streptococcosis in broodstock brook trout (Salvelinus fontinalis) in Wisconsin, USA

Abstract

In 2018, Vagococcus salmoninarum was isolated from two lots of broodstock "coaster" brook trout (Salvelinus fontinalis) containing ~1,500 fish at the Iron River National Fish Hatchery, at which time it was identified as the causative agent of a chronic coldwater streptococcosis epizootic. Clinical signs included exophthalmia, lethargy, erratic swimming and loss of equilibrium. Female fish experienced disproportionately higher morbidity and mortality than male co-inhabitants, and routinely retained eggs following spawning. The most consistent gross clinical sign was heart pallor and turbid pericardial effusion. An attempted treatment using florfenicol was ineffective at halting the epizootic, which spanned more than a year and resulted in >50% mortality before remaining fish were culled. As there is no previous documentation of V. salmoninarum at this hatchery or in this species, it is still unclear what circumstances led to this epizootic. The inability to treat this chronic disease led to the loss of valuable broodstock, hampering ongoing fishery conservation efforts in the Great Lakes Basin. K E Y W O R D Sbrook trout, coldwater streptococcosis, Salvelinus fontinalis, Vagococcus salmoninarum

Vagococcus salmoninarum II—qPCR, tropism and egg‐associated transmission

“…Fish were from two lots of mature 3‐ and 4‐year‐old brook trout broodstock, 44.4 ± 4.7 cm and 2.9 ± 1.0 kg (mean ± SD ), held in a single raceway. Fish had been experiencing elevated mortality throughout the previous year that was attributed to chronic coldwater streptococcosis caused by V. salmoninarium (Standish et al, in press).…”

“…Individual colonies were subcultured onto TSA slants for up to 48 hr for molecular and biochemical analyses. Bacterial isolation utilized the biochemical flow chart developed in a previous publication (Standish et al, this issue). All suspect isolates were initially confirmed using a V. salmoninarum ‐specific end‐point PCR (Ruiz‐Zarzuela et al, ).…”

“…A qPCR assay targeting a 107‐bp variable region of the V. salmoninarum pheS gene was developed in this study based on previously generated sequence data (Standish et al, in press). To do so, primers ( Vsal ‐qPCR Forward) 5′‐AGAGCGGGAAATTCGTCTTC‐3′ and ( Vsal ‐qPCR Reverse) 5′‐TACAAACGTTACAGCCTTCCC‐3′, and a probe ( Vsal ‐qPCR Probe) 5′‐6FAM/ACTGAACCT/ZEN/TCCGTCGAAGTTGATGT/IABkFQ‐3′, which contains a ZEN™/Iowa Black ® quencher (IDT; Integrated DNA Technologies), were developed using IDT PrimerQuest ® software (IDT).…”

“…Subsequently, V. salmoninarum has been isolated from salmonids in Australia (Schmidtke & Carson, ), numerous European countries (Ghittino et al, ; Michel, Nougayède, Eldar, Sochon, & Kinkelin, ; Ruiz‐Zarzuela, de Bias, Gironés, Ghittino, & MúAzquiz, ) and Turkey (Didinen et al, ). Vagococcus salmoninarum is particularly troubling as it affects broodstock post‐spawning, causing mortality rates >50% (Ghittino et al, ; Michel et al, ; Ruiz‐Zarzuela et al, ; Schmidtke & Carson, ; Standish et al, in press).…”

“…In a previous publication (Standish et al, in press), we describe the first isolation and characterization of V. salmoninarum from “coaster” brook trout ( Salvelinus fontinalis ) broodstock during a coldwater streptococcal epizootic at Iron River National Fish Hatchery (Wisconsin, USA). Vagococcus salmoninarum ‐infected fish exhibited lethargy, exophthalmia, loss of equilibrium and erratic swimming.…”