Mycobacterium tuberculosis infection of human dendritic cells decreases integrin expression, adhesion and migration to chemokines

Abstract

SummaryTuberculosis (TB) remains a major global health problem accounting for millions of deaths annually. Approximately one-third of the world's population is infected with the causative agent Mycobacterium tuberculosis. The onset of an adaptive immune response to M. tuberculosis is delayed compared with other microbial infections. This delay permits bacterial growth and dissemination. The precise mechanism(s) responsible for this delay have remained obscure. T-cell activation is preceded by dendritic cell (DC) migration from infected lungs to local lymph nodes and synapsis with T cells. We hypothesized that M. tuberculosis may impede the ability of DCs to reach lymph nodes and initiate an adaptive immune response. We used primary human DCs to determine the effect of M. tuberculosis on expression of heterodimeric integrins involved in cellular adhesion and migration. We also evaluated the ability of infected DCs to adhere to and migrate through lung endothelial cells, which is necessary to reach lymph nodes. We show by flow cytometry and confocal microscopy that M. tuberculosis-infected DCs exhibit a significant reduction in surface expression of the b 2 (CD18) integrin. Distribution of integrin b 2 is also markedly altered in M. tuberculosis-infected DCs. A corresponding reduction in the aL (CD11a) and aM (CD11b) subunits that associate with integrin b 2 was also observed. Consistent with reduced integrin surface expression, we show a significant reduction in adherence to lung endothelial cell monolayers and migration towards lymphatic chemokines when DCs are infected with M. tuberculosis. These findings suggest that M. tuberculosis modulates DC adhesion and migration to increase the time required to initiate an adaptive immune response.

Elevated interleukin‐27 levels in human neonatal macrophages regulate indoleamine dioxygenase in a STAT‐1 and STAT‐3‐dependent manner

“…All other gene expression assays were performed with unlabelled forward and reverse primers described previously in a reaction similar to above with SsoFast™ Evagreen ® Supermix (Bio‐Rad). Unlabelled human GAPDH and CD18 primer sequences were described previously . All remaining primer sequences were as follows: CD80, 5′‐tgacatcagcagagaact‐3′ (forward); CD80, 5′‐gaattgtggaaggcagtt‐3′ (reverse); CD86, 5′‐ctcaagataatgtcacagaact‐3′ (forward); CD86, 5′‐agatggtcatattgctcgta‐3′ (reverse); HLA‐DR, 5′‐agcagtcatcttcagcat‐3′ (forward); HLA‐DR, 5′‐atgttagagtacggagcaat‐3′ (reverse); human IDO1, 5′‐agaggagcagactacaag‐3′ (forward); human IDO1, 5′‐agcccacttcttcatcaa‐3′ (reverse); ARG1, 5′‐gaacagtgaacacagcag‐3′ (forward); ARG1, 5′‐ttacttaggtgggttaaggt‐3′ (reverse).…”

The presence of interleukin‐27 during monocyte‐derived dendritic cell differentiation promotes improved antigen processing and stimulation of T cells

“…Dendritic cells were harvested and phenotypic analysis was performed as previously described . Briefly, DCs were suspended in 0·1 ml of staining buffer (0·5% BSA in PBS) and Fc receptor was blocked for 20 min.…”

Mycobacterium tuberculosis infection of the ‘non‐classical immune cell’

“…Transmigration of dendritic cells through the endothelium is required to reach lymph nodes for antigen presentation. Studies have shown that M. tuberculosis can regulate dendritic cells integrin expression and thereby inhibit their adherence and migration in response to chemokine stimulation 58 . Delayed migration of dendritic cells was associated with reduced M. tuberculosis Ag85B‐specific CD4 T‐cell proliferation and activation, 59 which favours M. tuberculosis growth.…”