cytb as a New Genetic Marker for Differentiation of Prototheca Species

Abstract

Achlorophyllous unicellular microalgae of the genus (, ) are the only known plants that cause infections in both humans and animals, collectively referred to as protothecosis. Human protothecosis, most commonly manifested as cutaneous, articular, and disseminated disease, is primarily caused by, followed by and, sporadically, by and In veterinary medicine, however, is a major pathogen responsible for bovine mastitis, which is a predominant form of protothecal disease in animals. Historically, identification of spp. has relied upon phenotypic criteria; these were later replaced by molecular typing schemes, including DNA sequencing. However, the molecular markers interrogated so far, mostly located in the ribosomal DNA (rDNA) cluster, do not provide sufficient discriminatory power to distinguish among all spp. currently recognized. Our study is the first attempt to develop a fast, reliable, and specific molecular method allowing identification of all spp. We propose the mitochondrial gene as a new and robust marker for diagnostics and phylogenetic studies of the algae. The gene displayed important advantages over the rDNA markers. Not only did the gene have the highest discriminatory capacity for resolving all species, but it also performed best in terms of technical feasibility, understood as ease of amplification, sequencing, and multiple alignment analysis. Based on the species-specific polymorphisms in the partial gene, we developed a fast and straightforward PCR-restriction fragment length polymorphism (RFLP) assay for identification and differentiation of all species described so far. The newly proposed method is advocated to be a new gold standard in diagnostics of protothecal infections in human and animal populations.

A survey on the incidence of Prototheca mastitis in dairy herds in Lublin province, Poland

“…For these to be applied, DNA extraction was performed, essentially as reported elsewhere (Jagielski et al, 2017b). Species-and genotype-level identification was carried out using genotype-specific PCR assays, as described by Roesler et al (2006) and with a newly described PCR-restriction enzyme analysis (PCR-REA) assay of partial cytB gene, as proposed by Jagielski et al (2018).…”

Prototheca zopfii genotype II induces mitochondrial apoptosis in models of bovine mastitis

“…GT-II specific amplicon (165 bp) was detected with primers Proto18-4f (GACATGGCGAGGATTGACAGA) and PZGT-II/r (GTCGGCGGGGCAAAAGC) 18 . The P. zopfii genotype was further confirmed by restriction fragment length polymorphism (RFLP) analysis targeting the cytb gene fragment (599-668 bp) 5 . For this, a PCR mix (25 µL) containing cytb-F1 (5′ GyGTwGAACAyATTATGAGAG-3′) and cytb-R2 (5′-wACCCATAArAArTACCATTCwGG-3′) primers (10 μM each primer), DNA template (1 µL), and 2x EasyTaq PCR supermix (TransGen Biotech, AS111-11; 12.5 µL) was amplified under specific conditions (2 min at 95 °C, followed by 35 cycles of 30 sec at 95 °C, 30 sec at 50 °C, and 30 sec at 72 °C, with final extension of 5 min at 72 °C).…”

“…Bovine mastitis (inflammation of the udder), caused by infection with pathogenic microorganisms and destruction of milk-synthesizing tissues 1 , reduces milk production and quality and is an important financial threat to the dairy industry 2 . Prototheca zopfii, a chlorophyllous alga (family Chlorellaceae) unable to synthesize chlorophyll and with heterotrophic modes of nutrition 3,4 , is a major cause of mastitis in dairy cows 5,6 . Bovine protothecal mastitis can be clinical or subclinical.…”

Murine and Human Cathelicidins Contribute Differently to Hallmarks of Mastitis Induced by Pathogenic Prototheca bovis Algae

“…identified as P. bovis following a taxonomic approach commonly accepted for Prototheca (Roesler et al, 2006) and a cytb-based genotyping used for unambiguous Prototheca spp. identification (Jagielski et al, 2018) based on the protothecal phylogeny (Jagielski et al, 2019a).…”

“…The P. bovis genotype was further confirmed by restriction fragment length polymorphism (RFLP) analysis targeting the cytb gene fragment (599-668 bp) (Jagielski et al, 2018). For this, a PCR mix (25 µL) containing cytb-F1 (5 ′ GyGTwGAAC AyATTATGAGAG-3 ′ ) and cytb-R2 (5 ′ -wACCCATAArAArTA CCATTCwGG-3 ′ ) primers (10 µM each primer), DNA template (1 µL), and 2x EasyTaq PCR supermix (TransGen Biotech, AS111-11; 12.5 µL) was amplified under specific conditions (2 min at 95 • C, followed by 35 cycles of 30 s at 95 • C, 30 s at 50 • C, and 30 s at 72 • C, with final extension of 5 min at 72 • C).…”