Aegle marmelos extract rich in marmelosin exacted ameliorative effect against chromium‐induced oxidative stress and apoptosis through regulation of Gadd45 in HepG2 cell line

Abstract

Hexavalent chromium [Cr (VI)] is highly toxic compared to other valence states of chromium. In the process of metabolic reduction, Cr (VI) converts to trivalent chromium. Aegle marmelos (Bael), a sacred plant of India and its fruits are being consumed as traditional formulations against various diseases such as ulcer, gastric mucosal damage, inflammations, febrile delirium, acute bronchitis, anxiety, etc. The present study assessed the protective effects of marmelosin (MAR) from Aegle marmelos against K 2 Cr 2 O 7 -induced toxic effects in HepG2 cell line through its antiapoptotic mechanism. Results of the study revealed that pretreatment of MAR ameliorated cell viability, mitochondrial damage, and DNA damage induced by K 2 Cr 2 O 7 in HepG2 cell line as evidenced by cell morphology, MTT, LDH, and MMP assays. Pretreatment of MAR attenuated K 2 Cr 2 O 7 -induced oxidative stress by downregulating intracellular ROS and RNS. Further, pretreatment of MAR significantly downregulated K 2 Cr 2 O 7 -induced apoptotic markers, such as Bax, Caspase 3, and Gadd45. Our results suggested that application of marmelosin could be beneficial in ameliorating chromium-induced apoptotic cell death by suppressing oxidative stress and regulating excessive DNA damage. Practical applicationsThe study focused on protective mechanism of marmelosin from Aegle marmelos against chromium-induced oxidative stress for the first time. In this research, we reported that marmelosin effectively ameliorated K 2 Cr 2 O 7 -induced morphological changes such as oxidative stress and apoptotic cell death by regulating Gadd45, Bcl-2, Bax, and Caspase 3 gene expressions, and inhibition of intracellular ROS and RNS.The study provides a better understanding of the pharmacological mechanisms of Aegle marmelos and its bioactive compound, that is, marmelosin in the management of intoxication of heavy metals associated with excessive DNA damage.

Evaluation of the antioxidant activity, genotoxic, and cytotoxic effects of the ethanolic leaves extract of Abutilon hirtum (Lam.) Sweet using in vitro assays

“…The latter compound also has antioxidant activity [ 23 , 24 ]. The production of ROS, which damages the intracellular components of cells via oxidative stress, may be the cause of cytotoxic effects against cell lines [ 62 , 63 ]. In a similar study, A. indicum leaf extract triggered apoptotic cell death in human colon cancer cells at low concentrations, which was caused by DNA breakage and cell cycle arrest owing to an increase in ROS production [ 64 ].…”

Adaptogenic potential of ginsenosides against domoic acid‐induced toxicity by regulating neuronal stress and kinate receptors: Ex vivo and in silico studies

“…Transcript abundances of MAPK8 (F‐5’AAGGGACTATATTGATCAGTGG3’, R‐5’GTCCTTACTGTTGGTTGTAG3’) gene are examined by qRT‐PCR. The cycling conditions of qRT‐PCR are as follows: Initial denaturation at 95°C (30 s), 39 cycles of denaturation at 95°C (1–5 s), annealing at 58°C (30 s) and melt curve at 65–95°C (2–5 s), and the mean fold change in MAPK8 was calculated by 2 −ΔΔCT method after normalizing against β‐actin (F‐5’GATGTATGAAGGCTTTGGTC3’, R‐5’TGTGCATTTTATTGGTCTC3’) (Katram et al, 2021).…”

Nanoencapsulation of Green Tea Catechins : Cellular uptake, Transepithelial transport, and Bioefficacy of Epigallocatechin-3-gallate

“…The cell viability experiment was divided into four groups: Group I: Cells were treated with only dH 2 O (Control); Group II: Cells were treated with EGCG; and Group III: Cells were treated with GTCs; Group IV: Cells were treated with GTC-NPs. Further, MTT assay was performed according to Katram et al (2021) to determine the cellular viability of EGCG from GTCs and GTC-NPs. Various concentrations of EGCG, GTCs, and GTC-NPs (10 to 400 µg/mL) were studied for their effect on cell viability.…”