Human T‐cell leukemia virus type‐I oncoprotein Tax inhibits Fas‐mediated apoptosis by inducing cellular FLIP through activation of NF‐κB

Okamoto, Kazuo; Fujisawa, Jun–ichi; Reth, Michael; Yonehara, Shin

doi:10.1111/j.1365-2443.2006.00927.x

Cited by 71 publications

(82 citation statements)

References 41 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Although the role of c-FLIPL is controversial, c-FLIPS has been shown to be antiapoptotic and confers resistance to Fas-mediated apoptosis by blocking the proteolytic activation of caspase-8 in T lymphocytes [18][19][20][21][22][23]. Indeed, studies have shown that c-FLIPS plays a major anti-apoptotic role and prevents Fas-mediated apoptotic death in adult T leukemia and lymphoma cells [18,23,[31][32][33][34]. Our data showed that MAT II inhibition down-regulates c-FLIPS expression in a dose-dependent manner and reinstates Fas-mediated apoptotic signaling and cell death in T leukemic cells.…”

Section: Discussionmentioning

confidence: 99%

Inhibition of methionine adenosyltransferase II induces FasL expression, Fas-DISC formation and caspase-8-dependent apoptotic death in T leukemic cells

et al. 2008

View full text Add to dashboard Cite

show abstract

Section: Discussionmentioning

confidence: 99%

Inhibition of methionine adenosyltransferase II induces FasL expression, Fas-DISC formation and caspase-8-dependent apoptotic death in T leukemic cells

et al. 2008

View full text Add to dashboard Cite

show abstract

“…Preparation of lentiviral vectors. Constructs expressing shRNAs against mouse ERK7 were generated by subcloning the silencing oligonucleotides into the ApaI/ EcoRI site of the CSII-U6-MCS-EGFP vector, which was designed to coexpress shRNA and the EGFP reporter 50 . The sequences of the silencing oligonucleotides were as follows: ERK7 shRNA no.…”

Section: Methodsmentioning

confidence: 99%

ERK7 regulates ciliogenesis by phosphorylating the actin regulator CapZIP in cooperation with Dishevelled

et al. 2015

View full text Add to dashboard Cite

Cilia are essential for embryogenesis and maintenance of homeostasis, but little is known about the signalling pathways that regulate ciliogenesis. Here, we identify ERK7, an atypical mitogen-activated protein kinase, as a key regulator of ciliogenesis. ERK7 is strongly expressed in ciliated tissues of Xenopus embryos. ERK7 knockdown markedly diminishes both the number and the length of cilia in multiciliated cells, and it inhibits the apical migration of basal bodies. Moreover, ERK7 knockdown results in a loss of the apical actin meshwork, which is required for the proper migration of basal bodies. We find that the actin regulator CapZIP, which has been shown to regulate ciliogenesis in a phosphorylation-dependent manner, is an ERK7 substrate, and that Dishevelled, which has also been shown to regulate ciliogenesis, facilitates ERK7 phosphorylation of CapZIP through binding to both ERK7 and CapZIP. Collectively, these results identify an ERK7/Dishevelled/CapZIP axis that regulates ciliogenesis.

show abstract

“…Constructs expressing shRNAs against mouse Mab21-l3 (mMab21-l3 shRNAs) were generated by subcloning the silencing oligonucleotides into the ApaI/EcoRI site of the CSII-U6-MCS-EGFP vector, which was designed to co-express shRNA and the enhanced green fluorescent protein (EGFP) reporter 37 . The sequences of silencing oligonucleotides are as follows: mMab21-l3 shRNA #1-sense, 5 0 -AAAGCTACCCACCAGATTTCTC AAGAGAAAATCTGGTGGGTAGCTTTCCTTTTTT-3 0 ; mMab21-l3 shRNA #1-antisense, 5 0 -AATTAAAAAAGGAAAGCTACCCACCAGATTTTCTCTTGA GAAATCTGGTGGGTAGCTTTGGCC-3 0 ; mMab21-l3 shRNA #2-sense, 5 0 -GCA GAAGGTTGCTGCTATACTCTCAAGAGAAGTATAGCAGCAACCTTCTGCT TTTTTTT-3 0 ; and mMab21-l3 shRNA #2-antisense, 5 0 -AATTAAAAAAAAGCA GAAGGTTGCTGCTATACTTCTCTTGAGAGTATAGCAGCAACCTTCTGCG GCC-3 0 .…”

Section: Methodsmentioning

confidence: 99%

mab21-l3 regulates cell fate specification of multiciliate cells and ionocytes

et al. 2015

View full text Add to dashboard Cite

Cell fate specifications of multiciliate cells (MCCs) and ionocytes are commonly suppressed by the Notch pathway in developing epithelia, but are governed by different master regulators, suggesting the existence of a common regulator linking the Notch pathway to both MCC and ionocyte specifications. Here we show that a mab21 family gene, mab21-l3, represents the missing link. In Xenopus embryonic epidermis, mab21-l3 expression is specifically found in MCCs and ionocytes and is downregulated by the Notch pathway. Knockdown of mab21-l3 in Xenopus downregulates both MCC-specific and ionocyte-specific master genes, resulting in drastic loss of MCCs and ionocytes. In mouse tracheal epithelial cells, mab21-l3 expression is also downregulated by the Notch pathway and is required for MCC differentiation. Moreover, conditional gain of function of mab21-l3 rescues Notchinduced loss of MCCs and ionocytes in Xenopus. These results indicate that mab21-l3 acts downstream of the Notch pathway in cell fate specifications of MCCs and ionocytes.

show abstract

Human T‐cell leukemia virus type‐I oncoprotein Tax inhibits Fas‐mediated apoptosis by inducing cellular FLIP through activation of NF‐κB

Abstract: Human T-cell leukemia virus type I (HTLV-I

Cited by 71 publications

References 41 publications

Inhibition of methionine adenosyltransferase II induces FasL expression, Fas-DISC formation and caspase-8-dependent apoptotic death in T leukemic cells

Inhibition of methionine adenosyltransferase II induces FasL expression, Fas-DISC formation and caspase-8-dependent apoptotic death in T leukemic cells

ERK7 regulates ciliogenesis by phosphorylating the actin regulator CapZIP in cooperation with Dishevelled

mab21-l3 regulates cell fate specification of multiciliate cells and ionocytes

Contact Info

Product

Resources

About