Human Immunoglobulin G Recognizing Fibrinogen-Binding Surface Proteins Is Protective against both
            <i>Staphylococcus aureus</i>
            and
            <i>Staphylococcus epidermidis</i>
            Infections In Vivo

Vernachio, John; Bayer, Arnold S.; Ames, Brenda; Bryant, Dawn; Prater, Bradley D.; Syribeys, Peter J.; Gorovits, Elena L.; Patti, Joseph M.

doi:10.1128/aac.50.2.511-518.2006

Cited by 57 publications

(32 citation statements)

References 33 publications

(33 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Thus, other approaches should be explored. Active and passive immunization against ClfA has already been attempted in humans based on some protection obtained against S. aureus infections in different animal models (43)(44)(45). However, no single vaccine was effective in clinical trials (46).…”

Section: Discussionmentioning

confidence: 99%

Use of a Human-Like Low-Grade Bacteremia Model of Experimental Endocarditis To Study the Role of Staphylococcus aureus Adhesins and Platelet Aggregation in Early Endocarditis

et al. 2013

View full text Add to dashboard Cite

Section: Discussionmentioning

confidence: 99%

Use of a Human-Like Low-Grade Bacteremia Model of Experimental Endocarditis To Study the Role of Staphylococcus aureus Adhesins and Platelet Aggregation in Early Endocarditis

et al. 2013

View full text Add to dashboard Cite

“…It has previously been demonstrated that peptidoglycan from S. aureus is the important component of protection (34). In another study, immunization with INH-A21 (human IgG antibodies developed from the surface proteins clumping factor A [ClfA] and SdrG) induced phagocytic antibodies and protective immunity to staphylococcal infection in rats and rabbits (35). Further, the administration of various microbial surface components recognizing adhesive matrix molecules from S. aureus has been found to increase IgG specific antibody levels significantly, suggesting that the surface components can induce humoral immune responses (24).…”

Section: Resultsmentioning

confidence: 99%

Generation of a Novel Staphylococcus aureus Ghost Vaccine and Examination of Its Immunogenicity against Virulent Challenge in Rats

Vinod

Park

et al. 2015

Infect Immun

View full text Add to dashboard Cite

Staphylococcus aureus is a Gram-positive pathogen that causes a wide range of infections in humans and animals. Bacterial ghosts are nonliving, empty cell envelopes and are well represented as novel vaccine candidates. In this study, we examined the immunogenicity and protective efficacy of S. aureus ghosts (SAGs) against a virulent challenge in rats. Nonliving SAGs were generated by using the MIC of sodium hydroxide. The formation of a transmembrane lysis tunnel structure in SAGs was visualized by scanning electron microscopy. To investigate these SAGs as a vaccine candidate, rats were divided into four groups, A (nonimmunized control), B (orally immunized), C (subcutaneously immunized), and D (intravenously immunized). The IgG antibody responses were significantly stronger in the SAG-immunized groups than in the nonimmunized control group (P < 0.05). Moreover, a significant increase in the populations of CD4 ؉ and CD8 ؉ T cells was observed in all three immunized groups (P < 0.05). We also found that serum bactericidal antibodies were significantly elicited in the SAG-immunized groups (P < 0.05). Most importantly, the bacterial loads in the immunized groups were significantly lower than those in the nonimmunized control group (P < 0.01). These results suggest that immunization with SAGs induces immune responses and provides protection against a virulent S. aureus challenge.

show abstract

“…All chemicals were obtained from Sigma Chemical Co. unless otherwise noted. rHis-SdrG N123 (SdrG-A) was provided by Inhibitex, Inc. (4,31).…”

Section: Methodsmentioning

confidence: 99%

“…The gene encoding rSdrG N23 was amplified from a cloned His-SdrG N123 (SdrG-A) (4,31) by PCR (forward primer, 5ЈGGAATTCCCATATGGAACAAGGTTCGAATGTTAATC3Ј; reverse primer, 5ЈGGAATTCCAAGCTTTTATTTTTCAGGAGGCAAGTCAC 3Ј) and ligated into pET27b(ϩ) at the NdeI and HindIII sites, thereby excluding all coding sequence from the vector except for a single methionine at the amino terminus. The 3Ј primer was designed to include a stop codon before the HindIII site.…”

Section: Methodsmentioning

confidence: 99%

Expression of Staphylococcus epidermidis SdrG Increases following Exposure to an In Vivo Environment

et al. 2008

View full text Add to dashboard Cite

Human Immunoglobulin G Recognizing Fibrinogen-Binding Surface Proteins Is Protective against both Staphylococcus aureus and Staphylococcus epidermidis Infections In Vivo

Cited by 57 publications

References 33 publications

Use of a Human-Like Low-Grade Bacteremia Model of Experimental Endocarditis To Study the Role of Staphylococcus aureus Adhesins and Platelet Aggregation in Early Endocarditis

Use of a Human-Like Low-Grade Bacteremia Model of Experimental Endocarditis To Study the Role of Staphylococcus aureus Adhesins and Platelet Aggregation in Early Endocarditis

Generation of a Novel Staphylococcus aureus Ghost Vaccine and Examination of Its Immunogenicity against Virulent Challenge in Rats

Expression of Staphylococcus epidermidis SdrG Increases following Exposure to an In Vivo Environment

Contact Info

Product

Resources

About