HPV detection using primers MY09/MY11 and GP5+/GP6+ in patients with cytologic and/or colposcopic changes

Abstract

Introduction: Cervical cancer is one of the most common diseases among women, and cause considerable morbidity and mortality. Considering that cervical cancer is an important neoplasia in northeastern Brazil, and the prevalence of high-risk human papillomavirus (HPV) is directly associated with it, this work had aimed to correlate the cytological and/or colposcopic findings with HPV infection status, and verify the performance of MY09/MY11 and GP5+/6+ primers for HPV detection. Material and method: Patients in this study were from Penedo-AL, a city with high level of poverty (poverty rate of 60.62%). Out of 70 patients with cytological and/or colposcopic changes, 32 agreed to participate in the study. Results: Regarding cytology, 21 (30%) patients presented atypical squamous cells of undetermined significance (ASC-US); 20 (29%), atypical glandular cells of undetermined significance (AGUS); 12 (17%), low-grade intraepithelial lesion (LSIL); five (7%), high-grade intraepithelial lesion (HSIL); and 12 (17%), positive colposcopy. From these, 27 (84%) presented the band gene encoding for human ß-globin. From the 27 patients, eight (30%) were positive for HPV. The results showed that the deoxyribonucleic acid (DNA) of HPV was detected in 15% and 30% by using MY-PCR and GP +-PCR, respectively. Conclusion: This study suggests that more than one type of oligonucleotide primer should be used in clinical samples to increase sensitivity for the detection of HPV.

Prevalence of Human Papilloma Virus in Cervical Cells Among Patients With Abnormal Pap Smears.

“…Fifty years ago, for squamous histology, the cervical cellular abnormalities viewed as the precursor of cervical cancer were termed mild, moderate or severe dysplasia; severe dysplasia was distinguished from the more severe diagnosis of carcinoma in situ. In the late 1960s, Richart proposed the concept of intraepithelial neoplasia [9]. CIN3 encompassed severe dysplasia and carcinoma in situ, CIN2 replaced moderate dysplasia, and CIN1 later came to include both the cytologic evidence of HPV infection (koilocytotic atypia) and mild dysplasia.…”

“…Primers sequences are listed below, table (1) . TTGCTTTTCGGGATTTATGC CAGGACACAGTGGCTTTTGA E6-HPV16 204 bp 1395 2a MZNM2_F MZNM2_R GTGCCAGAAACCGTTGAATC TTGTGTTTCTCTGCGTCGTT E6-HPV18 151 bp 3b MY09 MY11 CGTCCACAAGAGGGATACTGATC GCACCAGGGATCATAACTAATGG L1-HR_HPV 450 bp 4c KM29 GH21 GGTTGGCCAATCTACTCCCAGG GGAAAATAGACCAATAGGCAG β-globin 345 bp a : Specific primers designed b : Specific primers used (Venceslau1 et al, 2014). c : Specific primers (TAKARA company, Japan).…”

Cervical cancer prevention and detection in focus

“…Prophylactic vaccination against HPV, now established in Brazil as a method of combating the disease, is an alternative with great promise for promoting a drastic reduction in the number of cervical cancer, and try to control the spread of the diseases, which is already happening in other countries, where has been used for a longer time. The future prospects is that the association of the vaccine with the triennial cytology may reduce in 94% the risk of cervical cancer (1) .On this line of discussion of methods and their applicability in relation to HPV-induced lesions, the present issue of the Brazilin Journal of Pathology and Laboratory Medicine ( Jornal Brasileiro de Patologia e Medicina Laboratorial [JBPML]) brings the article "HPV detection using primers MY09/MY11 and GP5+/GP6+ in patients with cytological and/or colposcopic changes" (3) , which discuss the applicability of polymerase chain reaction (PCR) as another element to be analyzed, since it has been the most performed technique by several areas of molecular diagnosis (2) . We are certain that the discussion of this topic will provide the reader a further element for consideration on the possibilities of enhancement of the methods to help the prevention and detection of cervical cancer.…”

“…On this line of discussion of methods and their applicability in relation to HPV-induced lesions, the present issue of the Brazilin Journal of Pathology and Laboratory Medicine ( Jornal Brasileiro de Patologia e Medicina Laboratorial [JBPML]) brings the article "HPV detection using primers MY09/MY11 and GP5+/GP6+ in patients with cytological and/or colposcopic changes" (3) , which discuss the applicability of polymerase chain reaction (PCR) as another element to be analyzed, since it has been the most performed technique by several areas of molecular diagnosis (2) . We are certain that the discussion of this topic will provide the reader a further element for consideration on the possibilities of enhancement of the methods to help the prevention and detection of cervical cancer.…”

Atividade mucosotrópica do Papilomavírus Humano (HPV) no processo carcinogênico em diferentes sítios de infecção.

“…Na primeira etapa foram utilizados os iniciadores degenerados MY09/MY11 e GP5+ e GP6+. Tais iniciadores são amplamente utilizados para a detecção do HPV em estudos clínicos e amplificam um amplo espectro de tipos do HPV (VENCESLAU et al, 2014).…”