Homogeneity of Streptococcus dysgalactiae from farmed amberjack Seriola dumerili in Japan

Furukawa²,

Matui

et al. 2011

Fish Sci

Self Cite

In Japan, Lactococcus garvieae infection has been the main fish disease in aquaculture. Although commercial oral and injectable vaccines have been used to prevent L. garvieae infection in Japan, L. garvieae has been isolated not only from unvaccinated fish but also from vaccinated fish in which immunity induced by vaccination had diminished. In order to obtain epidemiological information on this fish pathogen, we conducted biased sinusoidal field gel electrophoresis (BSFGE) pattern analysis and phage typing of L. garvieae isolates (n = 427) from fish in Japan. These isolates were obtained from 13 different fish species between 1980 and 2007. In the BSFGE analysis, L. garvieae isolates were classified into 17 groups (S1-S17) based on the SmaI digestion patterns and into four groups (A1-A4) based on the ApaI digestion patterns. Phage typing revealed five different phage susceptibility profiles (A-E) in L. garvieae isolates. Since 2005, comparisons of the results of phage typing and BSFGE have indicated the presence of a novel genotype (S16/A4) with phage type E. All the strains belonging to this type showed lincomycin sensitivity.

Section: Discussionmentioning

confidence: 99%

Epidemiological study on Lactococcus garvieae isolates from fish in Japan

Furukawa²,

Matui

et al. 2011

Fish Sci

Self Cite

“…The determined sequences included entire SOF‐FD amino acid sequences with 100% identity to each other. These results suggested the clonal expansion and homogeneity of S. dysgalactiae isolated from farmed fish in Japan (Nishiki et al ., ). Further studies are in progress to reveal the mechanism of variations in the SOF activity in fish GCSD isolates.…”

Section: Discussionmentioning

confidence: 97%

Cloning and expression of serum opacity factor in fish pathogenic Streptococcus dysgalactiae and its application to discriminate between fish and mammalian isolates

Horikiri

Itami

et al. 2011

FEMS Microbiol Lett

Self Cite

Lancefield group C Streptococcus dysgalactiae (GCSD) is known as a causative agent of bovine mastitis and cardiopulmonary diseases in humans. Recently, GCSD has been isolated from diseased fish in Japan. Almost all culture supernatants and sodium dodecyl sulfate extracts obtained from GCSD isolated from farmed fish possessed serum opacity activity. Serum opacity factor (SOF) is a bifunctional cell-associated protein that causes serum opacification. In this study, a gene coding SOF, which was named sof-FD, was identified from GCSD isolated from fish. The amino acid sequence of sof-FD showed 40.1-46.5% identity to those of other SOFs from mammalian strains of S. dysgalactiae and Streptococcus pyogenes. Repetitive fibronectin binding domains were also observed in sof-FD, the structures of which were similar to those of other SOFs, as previously reported. The amino acid sequence of SOF was identical among fish isolates. A primer set targeting the sof-FD gene was designed and applied to a PCR assay for discriminating fish isolates from mammalian isolates.

“…; Nishiki et al . ). The whole Sd‐Sip gene was amplified using designed primers of Sd‐Sip 1 (5′‐CTATTAGTCGCTACCTAGAAG‐3′) and Sd‐Sip 2 (5′‐CCTCACGTCTAGACGTAAG‐3′), according to the sequence of surface antigen gene in GenBank (accession no.…”

Section: Methodsmentioning

confidence: 97%

Cloning and expression of a surface immunogenic protein in Streptococcus dysgalactiae isolated from fish and its application in enzyme‐linked immunosorbent assays to diagnose S. dysgalactiae infections in fish

Journal of Fish Diseases

Minami

Itami

et al. 2013

Lancefield group C Streptococcus dysgalactiae (GCSD) causes severe necrotic lesions in the caudal peduncle in the genus Seriola farmed in Japan. To develop a sero-diagnostic method for GCSD infection in farmed fish, we attempted to identify a surface immunogenic protein that induces an antibody after infection with GCSD by immunoblot analysis using sera collected from infected fish. A protein obtained from sodium dodecyl sulfate (SDS) extracts of GCSD was identified as S. dysgalactiae surface immunogenic protein (Sd-Sip). Sd-Sip exhibited more than 94% homology with a surface antigen or a hypothetical protein from S. dysgalactiae mammalian isolates at the nucleotide sequence level. Expression of the recombinant Sd-Sip (rSd-Sip) was confirmed by immunoblot analysis, that is, its reactivity to GCSD-infected sera. Antibody detection ELISA using rSd-Sip and their usefulness for diagnosis of GCSD infection were examined. GCSD-infected sera collected from farmed amberjack, Seriola dumerili (Risso), showed strong reaction with immobilized rSd-Sip. Meanwhile, sera immunized by other pathogenic bacteria of fish were showed ELISA values similar to those of non-infected sera. These results of this study suggest that the antibody detection ELISA using rSd-Sip is an effective diagnostic method for GCSD infection in fish.