HLA-F coding and regulatory segments variability determined by massively parallel sequencing procedures in a Brazilian population sample

Abstract

Human Leucocyte Antigen F (HLA-F) is a non-classical HLA class I gene distinguished from its classical counterparts by low allelic polymorphism and distinctive expression patterns. Its exact function remains unknown. It is believed that HLA-F has tolerogenic and immune modulatory properties. Currently, there is little information regarding the HLA-F allelic variation among human populations and the available studies have evaluated only a fraction of the HLA-F gene segment and/or have searched for known alleles only. Here we present a strategy to evaluate the complete HLA-F variability including its 5' upstream, coding and 3' downstream segments by using massively parallel sequencing procedures. HLA-F variability was surveyed on 196 individuals from the Brazilian Southeast. The results indicate that the HLA-F gene is indeed conserved at the protein level, where thirty coding haplotypes or coding alleles were detected, encoding only four different HLA-F full-length protein molecules. Moreover, a same protein molecule is encoded by 82.45% of all coding alleles detected in this Brazilian population sample. However, the HLA-F nucleotide and haplotype variability is much higher than our current knowledge both in Brazilians and considering the 1000 Genomes Project data. This protein conservation is probably a consequence of the key role of HLA-F in the immune system physiology.

Validation of new HLA‐F alleles assigned by next‐generation sequencing

“…Therefore, the description of new alleles needs to be confirmed using other gold‐standard techniques. Here, we present validation of nine novel HLA‐F alleles described by Lima et al…”

“…The first primer sequences were GTGGCTCTCAAGGGCTCAG and GCAACAACCAAAGCATCGTA, from position −266 to 3249 according to the IPD‐IMGT/HLA Database, generating a 3515‐pb‐long amplicon. The second PCR was performed with primers described in Reference (GGAGAGAACACTCAGGTGGC and ATGGGCTGGGTGTTTAGTGG) from position −1942 to 4297 generating a 6239‐pb‐long amplicon. PCR fragments were sequenced using an NGS platform (MiSeq; Illumina, Eindhoven, The Netherlands).…”

“…The results from NGS data analysis, mono‐allelic sequencing and cloning/sequencing for [TG] repeats were all concordant. Eighty‐two SNPs were observed from position −238 to 3205, which were all described in the IPD‐IMGT/HLA Database or in Reference Nine alleles assigned at fourth field were not listed in the IPD‐IMGT/HLA Database but were described in Reference Their official names for HLA sequences submitted to the IPD‐IMGT/HLA Database have been officially assigned by the World Health Organization Nomenclature Committee in November 2018 (Table ). This followed the agreed policy that, subject to the conditions stated in the most recent Nomenclature Report …”

Human Leukocyte Antigen (HLA) and Immune Regulation: How Do Classical and Non-Classical HLA Alleles Modulate Immune Response to Human Immunodeficiency Virus and Hepatitis C Virus Infections?

“…Interestingly, other studies were unable to detect HLA-F transcripts in T cell lines but instead reported expression of HLA-F protein only in B cells and tissues containing B cells, such as tonsils and fetal liver (198). It is highly conserved, with 22 reported alleles encoding for four functional variants (199), suggesting a critical role in the immune response depicted by its expression on activated T-cells (200). HLA-F is expressed on monocytes and macrophages, as well on activated CD4 + T-cells as an open conformation that does not require β2M or peptide-binding (194, 197, 200).…”

Next‐generation sequencing of HLA‐G based on long‐range polymerase chain reaction

“…Here we present a long‐range PCR sequencing technique for genotyping HLA‐G using the Ion Torrent platform. Castelli et al have previously published an NGS method for the MiSeq platform to sequence the HLA‐G , HLA‐E , and HLA‐F genes . Apart from the fact that the sequencing platform differs between the two methods, we have also used different library preparation methods.…”