Histone modification dynamics at H3K27 are associated with altered transcription of in planta induced genes in Magnaporthe oryzae

Abstract

Transcriptional dynamic in response to environmental and developmental cues are fundamental to biology, yet many mechanistic aspects are poorly understood. One such example is fungal plant pathogens, which use secreted proteins and small molecules, termed effectors, to suppress host immunity and promote colonization. Effectors are highly expressed in planta but remain transcriptionally repressed ex planta, but our mechanistic understanding of these transcriptional dynamics remains limited. We tested the hypothesis that repressive histone modification at H3-Lys27 underlies transcriptional silencing ex planta, and that exchange for an active chemical modification contributes to transcription of in planta induced genes. Using genetics, chromatin immunoprecipitation and sequencing and RNA-sequencing, we determined that H3K27me3 provides significant local transcriptional repression. We detail how regions that lose H3K27me3 gain H3K27ac, and these changes are associated with increased transcription. Importantly, we observed that many in planta induced genes were marked by H3K27me3 during axenic growth, and detail how altered H3K27 modification influences transcription. ChIP-qPCR during in planta growth suggests that H3K27 modifications are generally stable, but can undergo dynamics at specific genomic locations. Our results support the hypothesis that dynamic histone modifications at H3K27 contributes to fungal genome regulation and specifically contributes to regulation of genes important during host infection.

TheMagnaporthe oryzaeMAP kinase Pmk1 regulates polycomb repressive complex 2 to reprogram genes expression for biotrophic growth

“…More importantly, we proved the PRC2 is exactly regulated by the MAP kinase Pmk1, which finely revealed Pmk1-downstream regulatory mechanism and PRC2 upstream regulatory mechanism. Together with the previous study by Zhang et al, (26), our study provides strong evidence that PRC2-mediated H3K27me3 is critical for modulating gene expression for biotrophic growth in M. oryzae.…”

“…In these studies, it has been shown that H3K27me3 correlates with gene silencing and plays a role in development, pathogenicity, and transcriptional regulation of secondary metabolite gene clusters (17,19). Recently, Functions of PRC2 was also revealed in M. oryzae, which indicated that PRC2-mediated H3K27me3 contributes to regulation of genes important during host infection, especially the effector proteins (26). However, it is far more unclear what's the role of PRC2 complex during fungi-plant interactions.…”

“…Recently, it is reported that M. oryzae PRC2 can regulate transcriptional dynamics of effector proteins through transcriptional repression, using ex planta experiments (26). In this study, we used in planta invasive hyphae (IH) samples to perform a chromatin immunoprecipitation sequencing (ChIP-seq), and show that PRC2-mediated H3K27me3 reprograms transcription of many genes for biotrophic growth of M. oryzae.…”

CRISPR-Cas12a induced DNA double-strand breaks are repaired by locus-dependent and error-prone pathways in a fungal pathogen

“…The fungal cultures were maintained under light at 25 °C on OTA to observe mycelial color change. For high-molecular-weight DNA extraction and protoplast preparation, related mycelial plugs for different strains from OTA were cultured in liquid CM at 28°C, 120rpm for 3-4 days as described before (50). In vitro crRNA synthesis and LbCas12a RNP assembly Oligos including T7 promoter (taatacgactcactatagg), LbCas12a direct repeat (taatttctactaagtgtagat), and 23-nt target sequences (Supplementary Table 2) were annealed and amplified to make the DNA template for in vitro RNA synthesis.…”

“…2h). Additionally, to rule out that our observations are dependent on the HYG donor DNA and hygromycin selection, we performed the same experiments with a different donor DNA sequence coding for resistance to the drug G418 (Geneticin) (50). We again recovered transformants with the buff mutant phenotype and found that 70% (14/20) were PCR negative and 25% (5/20) had PCR amplification that suggested a simple insertion.…”