Histone divergence in trypanosomes results in unique alterations to nucleosome structure

Abstract

Eukaryotes have a multitude of diverse mechanisms for organising and using their genomes, but the histones that make up chromatin are highly conserved. Unusually, histones from kinetoplastids are highly divergent. The structural and functional consequences of this variation are unknown. Here, we have biochemically and structurally characterised nucleosome core particles (NCPs) from the kinetoplastid parasite Trypanosoma brucei. A structure of the T. brucei NCP reveals that global histone architecture is conserved, but specific sequence alterations lead to distinct DNA and protein interaction interfaces. The T. brucei NCP is unstable and has weakened overall DNA binding. However, dramatic changes at the H2A-H2B interface introduce local reinforcement of DNA contacts. The T. brucei acidic patch has altered topology and is refractory to known binders, indicating that the nature of chromatin interactions in T. brucei may be unique. Overall, our results provide a detailed molecular basis for understanding evolutionary divergence in chromatin structure.

DNMT3B PWWP mutations cause hypermethylation of heterochromatin

“…Histone octamers were reconstituted as previously described (Deak et al, 2023 ; Wilson et al, 2016 ). Histones were rehydrated to ~5 mg/ml in unfolding buffer (20 mM Tris pH 7.5, 7 M Guanidine-HCl, 10 mM DTT) for 30 min at room temperature.…”

“…Nucleosome-wrapping DNA fragments were generated by PCR-based amplification as previously described (Deak et al, 2023 ; Wilson et al, 2019 ). A primer pair containing 5’ 6-FAM fluorophore on one oligo were synthesised and HPLC purified by Integrated DNA technologies (sequences ATGGAACACCATTGCACAGGATGTAT & /56-FAM/AATAGCCACCtGCCCTGGAG) for 175 bp widom-601 DNA.…”

“…Nucleosomes were reconstituted from octamers as previously described (Deak et al, 2023 ; Dyer et al, 2004 ; Wilson et al, 2016 ) with some minor modifications. Purified octamers were incubated with DNA, (FAM-175-bp Widom-601 or 193 bp Widom-603) wrapped using an 18 h exponential salt reduction gradient.…”

The N-terminal region of DNMT3A combines multiple chromatin reading motifs to guide recruitment

“…Histones were expressed and purified as previously described (Deak et al , 2023; Huntington Study et al , 2016; Muthurajan et al , 2004; Salguero et al ., 2019). Briefly, histones were expressed in BL21 (DE3 RIL) cells and resolubilised from inclusion bodies.…”

A lineage-specific protein network at the trypanosome nuclear envelope

“…Multiple nuclear functions are represented in T. brucei by very divergent systems, including mRNA processing and splicing, chromosome segregation, heterochromatinization and monoallelic exclusion at telomeric expression sites [ 4 , 23 ]. Divergence within the nuclear proteome of trypanosomes extends to histones, resulting in altered nucleosome structures [ 24 ] and elements of the transcriptional system [ 25 ], reflecting an extremely deep divide between T. brucei and animals, fungi, plants and most protists. Furthermore, many proteins identified at the nuclear envelopes of mammalian cells, trypanosomes and other organisms are lineage-specific; for example, animals do not share the majority of nuclear envelope trans -membrane (NET) proteins with even ‘closely’ related taxa such as yeasts [ 26 ].…”