Hippocampal NR3C1 DNA methylation can mediate part of preconception paternal stress effects in rat offspring

Niknazar, Somayeh; Nahavandi, Arezo; Peyvandi, Ali Asghar; Peyvandi, Hassan; Roozbahany, Navid Ahmady; Abbaszadeh, Hojjat-Allah

doi:10.1016/j.bbr.2017.02.014

Cited by 32 publications

(34 citation statements)

References 35 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The RNA concentrations were quantified by a spectrophotometer. cDNA was synthesized by reverse transcriptase with a cDNA synthesis kit (Fermentas, Thermo Fisher Scientific Inc., Leicestershire, UK) . The cDNA was amplified by PCR for 30 cycles for HIF‐1α and CXCR4 or 35 cycles for β‐Actin using the following primers: HIF‐1α; forward (5′_GGATTACCACAGCTGACCA‐3′) and reverse (5′_ GATCCAAAGCTCTGAGTAAT ‐3′), CXCR4; forward (5′_ ACACCGTCAACCTTTACAG ‐3′) and reverse (5′_ CTGTTGGTGGCGTGGACAA ‐3′) and β‐actin (as a loading control); forward (5′_TGTCCACCTTCCAGCAGATGT‐3′) and reverse (5′_AGCTCAGTAACAGTCCGCCTAGA‐3′).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Deferoxamine promotes mesenchymal stem cell homing in noise‐induced injured cochlea through PI3K/AKT pathway

et al. 2018

View full text Add to dashboard Cite

show abstract

Section: Methodsmentioning

confidence: 99%

“…Thermo Fisher Scientific Inc., Leicestershire, UK) 23. The cDNA was amplified by PCR for 30 cycles for HIF-1α and CXCR4 or 35 cycles for β-Actin using the following primers: HIF-1α; forward…”

mentioning

confidence: 99%

Deferoxamine promotes mesenchymal stem cell homing in noise‐induced injured cochlea through PI3K/AKT pathway

et al. 2018

View full text Add to dashboard Cite

show abstract

“…99 In mice, offspring derived from fathers exposed to sGC prior to mating exhibited altered DNA methylation and expression in steroid receptors in the hippocampus and kidney. 99 In mice, offspring derived from fathers exposed to sGC prior to mating exhibited altered DNA methylation and expression in steroid receptors in the hippocampus and kidney.…”

Section: Mechanis Ms Of Paternal Prog R Ammingmentioning

confidence: 99%

“…In rats, paternal stress that resulted in increased anxiety-related behaviour and elevated basal corticosterone in offspring was associated with increased DNA methylation and reduced hippocampal expression of Nr3c1, with a greater effect in males than females. 99 In mice, offspring derived from fathers exposed to sGC prior to mating exhibited altered DNA methylation and expression in steroid receptors in the hippocampus and kidney. 100 were consistent with those found in the cerebellum of autism patients at postmortem.…”

Section: Mechanis Ms Of Paternal Prog R Ammingmentioning

confidence: 99%

Prenatal programming of stress responsiveness and behaviours: Progress and perspectives

Hamada

Matthews

2019

J Neuroendocrinology

View full text Add to dashboard Cite

Parental exposure to stress or glucocorticoids either before or during pregnancy can have profound influences on neurodevelopment, neuroendocrine function and behaviours in offspring. Specific outcomes are dependent on the nature, intensity and timing of the exposure, as well as species, sex and age of the subject. Most recently, it has become evident that outcomes are not confined to first‐generation offspring and that there may be intergenerational and transgenerational transmission of effects. There has been intense focus on the mechanisms by which such early exposure leads to long‐term and potential transgenerational outcomes, and there is strong emerging evidence that epigenetic processes (histone modifications, DNA methylation, and small non‐coding RNAs) are involved. New knowledge in this area may allow the development of interventions that can prevent, ameliorate or reverse the long‐term negative outcomes associated with exposure to early adversity. This review will focus on the latest research, bridging human and pre‐clinical studies, and will highlight some of the limitations, challenges and gaps that exist in the field.

show abstract

“…For example, a rat model study demonstrated that chronic stress led to increased DNA methylation at Nr3c1 promoter which in turn induced increases in visceral pain [102]. Another rat study also revealed that the increased hippocampal Nr3c1 methylation levels causally mediated the effect of preconception paternal stress on the anxiety-related behaviors in offspring [103]. In a highly cited study, Weaver and colleagues demonstrated, also, that positive environments, modelled as rat maternal licking and grooming behaviors, can also impact long-term HPA axis programming and stress responses through alteration of hippocampal Nr3c1 promoter methylation [104].…”

Section: Epigenetic Adaptation: Negative Effectsmentioning

confidence: 99%

Environmentally Induced Epigenetic Plasticity in Development: Epigenetic Toxicity and Epigenetic Adaptation

Tian

Marsit

2018

Curr Epidemiol Rep

View full text Add to dashboard Cite

Purpose of Review Epigenetic processes represent important mechanisms underlying developmental plasticity in response to environmental exposures. The current review discusses three classes of environmentally-induced epigenetic changes reflecting two aspects of that plasticity, toxicity effects as well as adaptation in the process of development. Recent findings Due to innate resilience, epigenetic changes caused by environmental exposures may not always lead impairments but may allow the organisms to achieve positive developmental outcomes through appropriate adaptation and a buffering response. Thus, some epigenetic adaptive responses to an immediate stimulus or exposure early in life would be expected to have a survival advantage but these same responses may also result in adverse developmental outcomes as they persists into later life stage. Although accumulating literature has identified environmentally induced epigenetic changes and linked them to health outcomes, we currently face challenges in the interpretation of the functional impact of their epigenetic plasticity. Summary Current environmental epigenetic research suggest that epigenetic processes may serve as a mechanism for resilience, and that they can be considered in terms of their impact on toxicity as a negative outcome, but also on adaptation for improved survival or health. This review encourages epigenetic environmental studies to move deeper inside into the functional meaning of epigenetic plasticity in the development.

show abstract

Hippocampal NR3C1 DNA methylation can mediate part of preconception paternal stress effects in rat offspring

Cited by 32 publications

References 35 publications

Deferoxamine promotes mesenchymal stem cell homing in noise‐induced injured cochlea through PI3K/AKT pathway

Deferoxamine promotes mesenchymal stem cell homing in noise‐induced injured cochlea through PI3K/AKT pathway

Prenatal programming of stress responsiveness and behaviours: Progress and perspectives

Environmentally Induced Epigenetic Plasticity in Development: Epigenetic Toxicity and Epigenetic Adaptation

Contact Info

Product

Resources

About