High throughput detection of Coxiella burnetii by real-time PCR with internal control system and automated DNA preparation

Abstract

Background: Coxiella burnetii is the causative agent of Q-fever, a widespread zoonosis. Due to its high environmental stability and infectivity it is regarded as a category B biological weapon agent. In domestic animals infection remains either asymptomatic or presents as infertility or abortion. Clinical presentation in humans can range from mild flu-like illness to acute pneumonia and hepatitis. Endocarditis represents the most common form of chronic Q-fever. In humans serology is the gold standard for diagnosis but is inadequate for early case detection. In order to serve as a diagnostic tool in an eventual biological weapon attack or in local epidemics we developed a realtime 5'nuclease based PCR assay with an internal control system. To facilitate high-throughput an automated extraction procedure was evaluated.

Coxiella burnetii in bulk tank milk and antibodies in farm workers at Montería, Colombia

“…burnetii in cattle considering the low cost of the technique and the easiness of sample collection (Guatteo, 2007). In this study, the use of CoxP4 and CoxM9 primers (Panning et al ., 2008) for amplification of a fragment (435 pb) from IS1111gene allowed to increase assay sensitivity, because this gene is present at multiple copy number (7 to 110 copies), depending on C . burnetii strains (Klee et al ., 2006).…”

“…A conventional PCR was conducted with primers CoxP4 (5´-GGCTGCGTGGTGATGG; Genbank accession number: M80806) and CoxM9 (GTCCCGGTTCAACAATTCG), which amplify a 435 bp product of the transposase gene of C . burnetii (IS1111; Panning et al, 2008). Positive control was not used to avoid contaminations.…”

Dynamics of relationship between the presence of Coxiella burnetii DNA, antibodies, and intrinsic variables in cow milk and bulk tank milk from Danish dairy cattle

“…The reaction mixture was modified from Panning et al (2008) by substituting the internal control probe with 0.2 μM Coxlam (Applied Biosystems, Warrington, UK) and adding 5 μL of the PCR-generated internal control (IC) diluted 10 −8 (the IC DNA was adjusted to a level where it did not interfere with the magnitude of the C. burnetii-specific reaction.). The primers were CoxbS (gatagcccgataagcatcaac, nt position 1241-1261, GenBank accession M80806; Applied Biosystems) and CoxbAs (gcattcgtatatccggcatc, nt 1326-1307; Applied Biosystems) and the C. burnetii-specific probe was CoxbMGB (tcatcaaggcaccaat, nt 1272-1287; Applied Biosystems; Panning et al, 2008 amplifying lambda DNA (Invitrogen A/S, Taastrup, Denmark) with primer F CoxLam (gatagcccgataagcatcaaccgcatgaatatgaccagccaac; TAG Copenhagen A/S, Copenhagen, Denmark) and R CoxLam (gcattcgtatatccggcatcattcacgcaggggaaatatctttc; TAG Copenhagen A/S). In the qPCR reaction, IC was detected by probe Coxlam (ccacgaagccgcacgactccgc; Applied Biosystems).…”

A Case of Q Fever Prosthetic Joint Infection and Description of an Assay for Detection of Coxiella burnetii

“…The majority of PCR assays for C. burnetii have targeted the insertion sequence element IS1111 (6)(7)(8)(9)(10). As a mobile genetic element, there is the potential for IS1111 to move from one organism type to another, theoretically resulting in loss of specificity (11).…”