Heterotypic recognition of recombinant FMDV proteins by bovine T-cells: the polymerase (P3Dpol) as an immunodominant T-cell immunogen

Identification of T-Cell Epitopes in Nonstructural Proteins of Foot-and-Mouth Disease Virus

“…1C). This finding contrasts with the recognition of type O FMDV 3D as an immunodominant T-cell determinant by cattle lymphocytes, as recently reported (16). In addition to differences between cattle and swine in terms of antigenic recognition patterns, the lower antigenicity of 3D for porcine lymphocytes may also reflect differences between FMDV type C and type O.…”

“…Despite animal to animal variation, 19 peptides were stimulated in vitro lymphocytes from, at least, four of the six infected pigs analyzed ( Table 2). The responsive peptides define T-cell regions efficiently recognized by swine lymphocytes at the following amino acid positions: 3A and -[121-135], 3B [13][14][15][16][17][18][19][20][21][22][23] and - [39][40][41][42][43][44][45][46][47][48][49][50][51][52][53], and 3C [191][192][193][194][195][196][197][198][199][200][201][202][203][204][205][206][207][208][209][210]. Eleven of these peptides were also recognized by lymphocytes from at least three of the five heterotypically reinfected pigs analyzed (Table 3).…”

“…For practical reasons, such T-cell epitopes should be conserved among different FMDV serotypes. Peptides 3A-3 [11][12][13][14][15][16][17][18][19][20][21][22][23][24][25] (Table 5). These 3A and 3C peptides are frequently and efficiently recognized by porcine lymphocytes in both a homotypic and heterotypic manner.…”

A Safe Foot-and-Mouth Disease Vaccine Platform with Two Negative Markers for Differentiating Infected from Vaccinated Animals

“…This virus has been shown to grow in vitro and produce signs of FMD in cattle similar to A 24 WT. Therefore, to derive these double mutant plasmids, a PCR product spanning sequences between the unique restriction sites SalI and AgeI was produced that lacked 3B 1 and harbored a substitution in 3B 2 RQKP [9][10][11][12] with PVKV found at a similar position in BRV-2. The sequence encoding 3B 2 was modified by utilizing mutagenic sense (5=-GCCCGATGGAGAGACCAG TTAAAGTTAAAGTGAAAGCAAAAGCC) and antisense (5=-GGCTTTT GCTTTCACTTTAACTTTAACTGGTCTCTCCATCGGGC) oligonucleotides to introduce mutations in 3B 2 (also known as VPg 2 ; see Fig.…”

Identification of Major Histocompatibility Complex Restriction and Anchor Residues of Foot-and-Mouth Disease Virus-Derived Bovine T-Cell Epitopes

“…Since these antibodies were identified in serum, one could speculate that a systemic immune response of T cells against epitopes within NSP had occurred, at least in animal C813. In addition, experiments by Collen et al with recombinant FMDV proteins identified NSP 3D as an immunodominant region for T cells derived from cattle that were either infected, vaccinated and challenged, or repeatedly vaccinated (8). An explanation for this could be the reported association of the 3D protein with FMDV particles (23).…”