Heterogeneity of HLA‐DR2 haplotypes in Caucasoid Americans, African Americans, Chinese Americans, Native Americans and Xiamen Chinese

Abstract

HLA-DR, -DQ specificities were determined by PCR amplification with SSOP in 4560 individuals: Caucasoid Americans (CA), African Americans (AA), Chinese Americans (ChA), Native Americans (NA) and Xiamen Chinese (XC). DR2 subtypes were compared amongst the five ethnic populations. The DRB1*1501-DRB5*0101 haplotype was found to be the most frequent in all populations except African Americans, in which DRB1*1503-DRB5*0101 was the predominant haplotype, accounting for 65% of DR2 subtypes. In contrast to Caucasoid Americans, the DRB1*1602 is strongly associated with the DRB5*0101 allele in Chinese populations. The presence of DRB5*0203 and DRB1*1602-DRB5*0101 haplotypes in Chinese populations, especially in Xiamen Chinese, suggests that various DR2 haplotypes may be generated via multiple gene conversion events together with point mutations and reciprocal recombination. The strong DR and DQ associations are found in DRB1*1501/DQB1*0602 (66.22%) for CA, DRB1*1503/DQB1*0602 (56.58%) for AA, DRB1*1501/DQB1*0602 (30.20%) and DRB1*1602/DQB1*0502 (15.76%) for ChA, DRB1* 1501/DQB1*0602 (41.55%) and DRB1*1602/DQB1*0301 (40.25%) for NA, and DRB1*1501/DQB1*0602 (30.26%) and DRB1*1602/DQB1*0502 (25.81%) for XC.

Black Patients of African Descent and HLA-DRB1*15:03 Frequency Overrepresented in Epidermolysis Bullosa Acquisita

“…Leaving that epicenter, the frequencies decreased concentrically (Figure 2; Solberg et al, 2008). The HLA-DRB1*15:03 commonality in black Americans (26.3%; Lee et al, 1999), Colombians (18%, 15%, and 13%, respectively, for Providencia, Cauca, and Choco groups; Trachtenberg et al, 1996), and Jamaicans (10.2%; Heward et al, 2002) suggests that HLA-DRB1*15:03 could be an ethnic marker of African origin. Our analyses showed that HLA-DRB1*15:03 allele was significantly more frequent among our black-skinned EBA patients from sub-Saharan countries than the control population, comprised of individuals from sub-Saharan countries where this incidence had been determined (Middleton et al, 2003;Solberg et al, 2008): Central African Republic (Aka Pygmies), Mali, Ethiopia, Zimbabwe, and Senegal, with the exception of Cameroon.…”

Human leukocyte antigen phenotypes and hepatitis C viral load

“…HLA phenotypes of all subjects were determined by sequence-specific oligonucleotide probe hybridization (SSOPH) (Lee et al, 1996(Lee et al, , 1999Wu et al, 2004).…”

“…To study the relationship between HLA phenotypes and HCV viral load, we have determined the phenotypes of HLA-A, -B, and -DRB1 for all anti-HCV positive subjects by sequence-specific oligonucleotide probe hybridization (SSOPH) (Lee et al, 1996(Lee et al, , 1999Wu et al, 2004). Due to small sample size for subjects with HBsAg-positivity, we subsequently restricted further analyses to HBsAg-negative subjects only.…”

Group-Specific Amplification of cDNA From DRB1 Genes. Complete Coding Sequences of Partially Defined Alleles and Identification of the New Alleles DRB1*040602, DRB1*111102, DRB1*080103, and DRB1*0113

“…This DRB1 allele is mainly associated with DRB5*010101 and DQB1*0602, but it has been described either without the DRB5 gene or with any other DQB1 allele [27]. EXON 1 10 20 30 40 50 60 70 80 90 100 DRB1*110101 ATGGTGTGTCTGAGGCTCCCTGGAGGCTCCTGCATGGCAGTTCTGACAGTGACACTGATGGTGCTGAGCTCCCCACTGGCTTTGGCTGGGGACACCAGAC DRB1*111101 ************************************************************************************** The complete coding region of DRB1*1503 was sequenced from two Spanish Caucasian individuals, both demonstrating the predicted DRB1*1503-DRB5*010101-DQA1*010201-DQB1*0602 haplotype (Table 3).…”