Hereditary Resistance to 1,25-Dihydroxyvitamin D

Marx, Stephen J.; Liberman, Uri; Eil, Charles; Gamblin, George T.; DeGrange, D A; Balsan, S

doi:10.1016/b978-0-12-571140-1.50019-0

Cited by 24 publications

(23 citation statements)

References 57 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The availability of cloned receptor sequences will expedite studies of vitamin D-responsive regulatory elements. In addition, expression of truncated receptors (unpublished work) and examination of aberrant receptors found in vitamin D-dependent rickets type 11 (36) will help to define functional domains of the receptor molecule.…”

Section: Resultsmentioning

confidence: 99%

Cloning and expression of full-length cDNA encoding human vitamin D receptor.

Baker¹,

McDonnell²,

Hughes³

et al. 1988

Proc. Natl. Acad. Sci. U.S.A.

851

376

View full text Add to dashboard Cite

containing 1 x 106 cpm of nick-translated probe per ml (12). After being washed three times at 60'C in 0.5 x SSC to remove excess probe, the filters were exposed to X-ray film (Kodak X-Omat S) at -700C with an intensifying screen. Hybridization-positive phage were isolated, and their inserts were subcloned into the EcoRI site of M13mp8. AVDR1 was obtained in this fashion and subsequently used to screen an Okayama-Berg (13) T47D cDNA library (provided by G. Ringold, Stanford University), yielding clone VDR3, and a specifically primed AgtlO T47D library yielding clone AVDR2. The latter was made by substituting the oligonucleotide 5' ACACACCCCACAGATCCGGGG 3' for oligo(dT) in the first strand reaction (underlined in Fig. 2).DNA Sequence Analysis. Three overlapping clones were used to generate the full-length VDR sequence cDNA inserts to be sequenced. These clones were subcloned into the EcoRI site of M13mp8 for sequencing by the dideoxynucleotide chain-termination method (14). Primers were either the M13 universal primer or sequence-derived oligonucleotides.RNA Blot Hybridization. Total RNA was isolated from each of three cell lines (15), and the mRNA fraction was selected by successive passages over oligo(dT)-cellulose (16). The mRNA samples (10 ,ug) were resolved on a 1% formaldehyde-agarose gel (17) and then transferred electrophoretically to a nylon membrane (Nytran; Schleicher & Schuell). The filter was hybridized to nick-translated hVDR-1(1 x 108 cpm/,ug; 1 x 106 cpm/ml) using the conditions described above.Expression

show abstract

Section: Resultsmentioning

confidence: 99%

Cloning and expression of full-length cDNA encoding human vitamin D receptor.

Baker¹,

McDonnell²,

Hughes³

et al. 1988

Proc. Natl. Acad. Sci. U.S.A.

851

376

View full text Add to dashboard Cite

show abstract

“…Hereditary resistance to 1,25- (1). The underlying defects leading to the resistance of target tissues to 1,25(OH) 2D have not yet been identified.…”

Section: Introductionmentioning

confidence: 99%

“…Results of a recent study, in which skin fibroblast extracts from eight such patients were evaluated for the detection and quantitation of 1,25 (OH)2D3 receptors using a monoclonal antibody to the chick receptor molecule, suggest that resistance to the hormonal form of the vitamin is the consequence of structural variations in the receptor molecule and is not due to defective receptor synthesis (2). Whatever the basic molecular defect(s), the accumulating data clearly show a great heterogeneity in the clinical features ofpatients with hereditary resistance to 1,25(OH)2D and in their response to therapy with vitamin D derivatives (1). Favorable clinical responses to the administration ofpharmacological doses of native vitamin D, 25(OH)D3, la(OH)D3, 1,25(OH)2D3 (3)(4)(5)(6)(7)(8)(9)(10), or 24,25(OH)2D3 (11) have been reported in some patients.…”

Section: Introductionmentioning

confidence: 99%

Long-term nocturnal calcium infusions can cure rickets and promote normal mineralization in hereditary resistance to 1,25-dihydroxyvitamin D.

Balsan¹,

Garabédian²,

Larchet³

et al. 1986

J. Clin. Invest.

253

View full text Add to dashboard Cite

We report the beneficial effects of calcium infusions in a child with hereditary resistance to 1,25(OH)2D and alopecia. This patient after transient responsiveness to vitamin D derivatives became unresponsive to all therapy despite serum 1,25(OH)2D concentrations maintained at levels -100-fold normal. A 7-mo trial with calcium infusions led to correction of biochemical abnormalities and healing of rickets. Bone biopsies (n = 3) showed a normal mineralization and the disappearance of the osteomalacia. Cultures of bone-derived cells demonstrated a lack of activation of 25-hydroxyvitamin D 24-hydroxylase and osteocalcin synthesis by 1,25(0H)2D3 (10-' and 10' M). These results demonstrate that (a) even in the absence of a normal 1,25(OH)2D3 receptor-effector system in bone cells, normal mineralization can be achieved in humans if adequate serum calcium and phosphorus concentrations are maintained; and (b) calcium infusions may be an efficient alternative for the management of patients with this condition who are unresponsive to large doses of vitamin D derivatives.

show abstract

“…Clinical diversity has been evidenced by a variable calcemic response to prolonged treatment with high doses of calciferol analogues and by the presence or absence of alopecia (21). In five families wherein multiple affected members have been studied, clinical features have been consistent among affected members of the family (4,5,16,19).…”

Section: Introductionmentioning

confidence: 96%