Haplotype variation in bovine Toll-like receptor 4 and computational prediction of a positively selected ligand-binding domain

Abstract

Toll-like receptor 4 (TLR4) is a cell-surface receptor that activates innate and adaptive immune responses. Because it recognizes a broad class of pathogen-associated molecular patterns presented by lipopolysaccharides and lipoteichoic acid, TLR4 is a candidate gene for resistance to a large number of diseases. In particular, mouse models suggest TLR4 as a candidate gene for resistance to major agents in bovine respiratory disease and Johne's disease. The coding sequence of bovine TLR4 is divided into three exons, with intron͞exon boundaries and intron sizes similar to those of human TLR4 transcript variant 1. We amplified each exon in 40 individuals from 11 breeds and screened the sequence for singlenucleotide polymorphisms (SNPs). We identified 32 SNPs, 28 of which are in the coding sequence, for an average of one SNP per 90 bp of coding sequence. Eight SNPs were nonsynonymous and potentially alter specificity of pathogen recognition or efficiency of signaling. To evaluate the functional importance of these SNPs, we used codon-substitution models to detect diversifying selection in an extracellular region that may physically interact with ligands. One nonsynonymous SNP is located within this region, and other substitutions are in adjacent regions that may interact with coreceptor molecules. The 32 SNPs were found in 20 haplotypes that can be assigned to geographic ranges of origin. Haplotype-tagging SNP analysis indicated that 12 SNPs need to be genotyped to distinguish these 20 haplotypes. These data provide a basic understanding of bovine TLR4 sequence variation and supply haplotype markers for disease association studies.

Susceptibility to paratuberculosis infection in cattle is associated with single nucleotide polymorphisms in Toll-like receptor 2 which modulate immune responses against Mycobacterium avium subspecies paratuberculosis

“…Average frequencies of one SNP per 689 bp regarding all SNP, and one non-synonymous SNP per 1009 bp were found. Previous studies on other genes in cattle have reported higher SNP frequencies with an average of one SNP per 143 bp (Heaton et al, 2001) and one SNP per 90 bp (White et al, 2003). However, our data are consistent with SNP frequencies described in humans, where frequencies range from one SNP per 657 bp (Wang et al, 1998), to one SNP per 1001 bp (Lai et al, 1998), in the total human genome.…”

“…The putative LRR domain of bovine TLR2 has the highest average SNP frequency. These data are in line with studies in bovine, human and mouse TLR4 (Smirnova et al, 2000(Smirnova et al, , 2001White et al, 2003). In addition, the small number of non-synonymous SNP in the transmembrane and TIR domains confirms data about those conserved domains.…”

Diversity and evolution of 11 innate immune genes in Bos taurus taurus and Bos taurus indicus cattle

“…Herein, we characterized 220 bovine polymorphisms within the 10 TLRs and PGLYRP1 (27)(28)(29)33) in 37 cattle breeds representing Bos taurus taurus, Bos taurus indicus, and subspecific hybrids. We also comprehensively report on bovine TLR and PGLYRP1 haplotype structure, haplotype sharing among breeds and subspecific lineages, and provide median joining networks as putative representations of haplotype evolution (34).…”

Detection of Polymorphism in Exon 2 of Toll-like Receptor 4 Gene of Indian Buffaloes Using PCR-SSCP Technique

“…Among these regions, the putative coreceptor binding region is considered as an important region for pathogen recognition (White et al, 2003). Since TLR4 exon 2 includes putative coreceptor binding region 1 (24-273), this region of buffalo gene was selected for the analysis in the present study.…”

“…PCR primers, forward 5'TCTTTGCTCGTCCCAGTTAGC3' a n d reverse 5'AAGTGAATGAAAAGGAGACC TCA 3' (White et al, 2003) were used to amplify a 400 bp fragment of buffalo TLR 4 exon 2 sequence. Amplification was performed in 25 pl reaction containing approximately 100 ng of genomic DNA, 5 pmole of each primer, 200 pM of dNTPs (Bioron), one unit of Taq DNA polymerase (Banglore Genei, Bangalore, India) and 2.5 pl of 1OX reaction buffer supplied with the enzyme (containg 1.5 mM MgC1,).…”