GREM, a technique for genome-wide isolation and quantitative analysis of promoter active repeats

Abstract

We developed a technique called GREM (Genomic Repeat Expression Monitor) that can be applied to genome-wide isolation and quantitative analysis of any kind of transcriptionally active repetitive elements. Briefly, the technique includes three major stages: (i) generation of a transcriptome wide library of cDNA 5′ terminal fragments, (ii) selective amplification of repeat-flanking genomic loci and (iii) hybridization of the cDNA library (i) to the amplicon (ii) with subsequent selective amplification and cloning of the cDNA-genome hybrids. The sequences obtained serve as ‘tags’ for promoter active repetitive elements. The advantage of GREM is an unambiguous mapping of individual promoter active repeats at a genome-wide level. We applied GREM for genome-wide experimental identification of human-specific endogenous retroviruses and their solitary long terminal repeats (LTRs) acting in vivo as promoters. Importantly, GREM tag frequencies linearly correlated with the corresponding LTR-driven transcript levels found using RT–PCR. The GREM technique enabled us to identify 54 new functional human promoters created by retroviral LTRs.

At Least 50% of Human-Specific HERV-K (HML-2) Long Terminal Repeats Serve In Vivo as Active Promoters for Host Nonrepetitive DNA Transcription

“…Transcript levels were measured relative to the housekeeping beta-actin gene transcript level. For a sample of 20 HS LTRs, the frequencies of ELT occurrence in the seminoma correlated linearly with RT-PCR-measured transcript levels (Table 2), with a correlation coefficient of 0.92, as shown previously for a testicular parenchyma library (7). Such a correlation suggests that in this case, GREM was adequate for quantitative characterization of LTRs displaying promoter activity.…”

“…We used GREM to compare the HS element promoter activities in normal testicular parenchyma and in a seminoma, a testicular germ cell tumor derived from surgical material taken from the same adult patient. A complete GREM experimental protocol was published and discussed in detail previously (7). Briefly, TAAGTGGATATAATTACTAAGTCCAGG AC068381 gLTR80 CCAACATCTGTCTCTTCCCTG AP002754 gLTR81 GACCATTTGCATGGACAAATC AL451165 gLTR99 CCATCCCTTCCATGCCTTAG AC069420 gLTR100 AGCTTTGTGGATTGTAATTTGG AC072054 gLTR108 CTCAGTAAAGATGAAGGTATGACAAG AL139421 gLTR109 GAGGCAGAGGTTGCAGTGAGCC AC002400 gLTR113 ATAAAGGAGAAATCTTCCATGAAG AC026424 gLTR115 TGTGACGGTATAATGGCCTCT AC008648 gLTR121 TGCAATGTTCATGTTCGCTCC AC012175 gLTR129 GGTTATGAATAAAGTTCCCTCGG AC027750 gLTR131 AGAATAGAGCGAACAGACACAG AL352982 gLTR138 AGGTTATTGATACATTGCATCGAC AC023201 gLTR139 CAATAACAGTCATTCTCACTGGAG AC118278 gLTR140 GAGTTGGGATGTGGTCTTAGG AL353588 gLTR141 CTCATGCTAAACTGTCTGATTATGC AC105049 gLTR145 TTGTGCAAACTGTCTACAGCCA BC001407 gLTR149 AACATACAGGTTGAGGCCAGG AC016577 gLTR152 TTGTAGCTGACCAACAGCCTGC AC068213 gLTR155 TTAGGCCAGGGTCTCACTGAG U47924 HERV-K (HML-2) proviral gag gene-specific primer Gag rev AATGGCCCAATCATTCCATA Unique primers specific to known human genes…”

“…Recently, we developed a new technique, termed genomic repeat expression monitoring (GREM), for experimental genome-wide identification of promoter-active repetitive elements (7). The technique is based on hybridization of repeat 3Ј-flanking genomic DNA to pools of total cDNA 5Ј-terminal parts, followed by selective PCR amplification of the genomic DNA-cDNA heteroduplexes.…”

Microarray-based Identification of Individual HERV Loci Expression: Application to Biomarker Discovery in Prostate Cancer

“…In order to trace the expression of individual locus within a family, approaches based on the PCR amplification of conserved regions combined with subsequent cloning and sequencing enabled transcriptionally active distinct elements of the HML-2 29,30 or HERV-E4.1 31 families to be identified. Also ending by cloning and sequencing steps, the genome repeat expression monitoring technique aiming to identify promoters among repeats identified active HML-2 specific human solitary LTRs 32,33 . We successively developed two generations of high-density microarrays dedicated to the analysis of the HERV transcriptome, introducing methodologies suitable for repeated element probe design in order to minimize cross reactions between paralogous elements within a family 34,35 .…”

Nutrition, Histone Epigenetic Marks, and Disease

“…Evidence that epigenetic mechanisms are important in retroelement control and cancer prevention are as follows (Chen et al 1997;Chen and Townes 2000;Chew et al 2008;Jahner et al 1982;Slotkin and Martienssen 2007;Walsh et al 1998;Yoder et al 1997): Firstly, the human genome contains at least 54 transcriptionally active LTRs (Buzdin et al 2006). Retrotransposons and any integrating virus produces DNA breaks during integration (Gasior et al 2006) that may directly or indirectly lead to tumorigenesis (Fan 2007).…”