Gonadal sex differentiation and effects of dietary methyltestosterone treatment in sablefish (Anoplopoma fimbria)

Abstract

Methods for sex control are needed to establish monosex aquaculture of sablefish (Anoplopoma fimbria). Here we conducted the first characterization of sex differentiation by histology and hormonal sex reversal experiment in sablefish. Ovarian differentiation was first discernible at ~80 mm fork length (FL) and characterized by development of lamellar structures and onset of meiosis. Testes exhibited a dual-lobe appearance over much of their length and remained non-meiotic until males were ≥520 mm FL (2 years post-fertilization). Juveniles with undifferentiated gonads were provided diets containing 0 (control), 5 or 50 mg 17α-methyltestosterone (MT)/kg for 2 months. Following treatment, controls possessed either ovaries or non-meiotic testes, whereas MT-treated fish exhibited meiotic testes (60% of the fish), intersex gonads (~30%), or gonads that appeared sterile (~10%). A genetic sex marker revealed that all intersex fish were genetic females, although other females appeared to be completely sex reversed (i.e., neomales). One year after treatment, MT-treated fish possessed non-meiotic testes similar to control males or intersex gonads with reduced ovarian features, presumably due to atresia following MT withdrawal. Milt collected from neomales and genetic males 3 years post-treatment permitted sperm motility analyses; however, neomale sperm were virtually immotile. These results demonstrated that sablefish are differentiated gonochorists and that MT treatment from 76 to 196 mm FL induced permanent masculinization of a portion of the genetic females, but acquisition of sperm motility was impaired. Earlier administration of MT may be necessary to sex reverse a higher proportion of genetic females and reduce negative effects on fertility.

Masculinization under combined administration of an androgen and an aromatase inhibitor in the Ussuri catfish,Pelteobagrus ussuriensis(Dybowski, 1872)

“…A minimum hormone dosage is needed to sex‐reverse fish during this labile period (Blázquez et al, ; Pandian, ). It is very difficult for sex reversal to be induced by hormones once sex differentiation is completed in many fish species (Baroiller et al, ; Luckenbach & Fairgrieve, ). Consequently, sex manipulation is typically achieved by exposing sexually undifferentiated fish to exogenous hormones to produce the desired sex (Beardmore et al, ; Pandian, ; Piferrer, ).…”

“…Sex hormones are the most extensively applied agents to manipulate masculinization as they regulate gonadal development in teleost (Liu, Cui, Hou, Xu, & Chen, & H.X., ; Liu, ; Uchida, Yamashita, Kitano, & Iguchi, ; Yang, ; Zerulla et al, ). 17α‐methyltestosterone (MT) is a synthetic steroid sex hormone and an effective androgen to induce masculinization in fish (Luckenbach & Fairgrieve, ; Piferrer, ). Successful sex reversal by administering MT has been reported in quite a few fish species, such as Paralichthys olivaceus (Kitano, Takamune, Nagahama, & Abe, ), Pimephales promelas (Ankley, Jensen, Kahl, Korte, & Makynen, ), Oreochromis niloticus (Beardmore et al, ; El‐Sayed, Abdel‐Aziz, & Abdel‐Ghani, ; Liu, ), and Solea senegalensis (Viñas, Asensio, Cañavate, & Piferrer, ).…”

Effect of 17β‐oestradiol on the sex ratio of tambaqui, Colossoma macropomum

“…Therefore, other features had to be considered for gender identification, specifically the germinal epithelium, which either presented very typical ovarian lamellae containing oogonial clusters surrounded by prefollicle cells (ovary) or spaced single type A spermatogonia surrounded by one or two Sertoli cells (testis). This early sex identification—based on these structures (before the meiosis in the females)—has been recently used in sablefish (Luckenbach & Fairgrieve, ). The highest E 2 dose (120 mg/kg feed) produced over 80% females and less than 20% intersex individuals.…”

“…All E 2 ‐treated groups presented intersex fish, even those that received the lowest E 2 dose. The relatively common presence of fish presenting ovarian and testicular tissues simultaneously in studies of monosex production (Ahmed et al, ; Lin et al, ; Luckenbach & Fairgrieve, ) is a consequence of a suboptimal dose and/or hormonal treatment period (Johnstone et al, ; Wang et al, ). Intersex fish are also observed in low doses for feminization of the bluegill sunfish Lepomis macrochirus , while doses from 150 to 200 mg E 2 /kg diet resulted in a 100% female population (Wang et al, ).…”

What goes up must come down: Diel vertical migration in the deep‐water sablefish (Anoplopoma fimbria) revealed by pop‐up satellite archival tags

“…To non‐invasively determine the genetic sex of each fish, a polymerase chain reaction (PCR) assay of the sablefish sex marker gsdf (Rondeau et al., ) was conducted on DNA isolated from fin clips (taken during tagging) using the DNeasy Blood & Tissue Kit (Qiagen, Germantown, MD, USA). PCRs for genetic sexing had a total volume of 25 μl consisting of 1 μl of DNA template, 12.5 μl of Amplitaq Gold master mix (Applied Biosystems, Foster City, CA, USA), and 80 n m each of a forward (6FAM‐GTGCAGCCAAATATTGCRTA) and reverse primer (TGTCAACATTATGTTTTGAGGTGT) for gsdf (Luckenbach & Fairgrieve, ). For reaction analysis, 9.75 μl of Hi‐Di formamide and 0.25 μl of Genescan‐1200 LIZ size standard (LT) were combined with 1 μl of PCR product.…”