Giardia lamblia assemblages A and B isolated from symptomatic and asymptomatic persons in Hamadan, west of Iran

Kashinahanji, Manizheh; Haghighi, Ali; Bahrami, Fatemeh; Fallah, Mohammad; Saidijam, Massoud; Matini, Mohammad; Maghsood, Amir Hossein

doi:10.1007/s12639-019-01139-x

Cited by 11 publications

(5 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Several studies have described the relationships between assemblages and symptoms, but no clear association was demonstrated between the Giardia assemblage and clinical signs. Our results illustrated no significant association between Giardia assemblages and symptoms, in agreement with previous findings in Syria and Iran [ 27 , 50 , 51 ], whereas other studies found that assemblage A was considerably associated with symptoms in Egypt [ 31 ] and Iran [ 52 ]. Meanwhile, a study in Saudi Arabia revealed that clinical symptoms were strongly related with assemblage B [ 53 ].…”

Section: Discussionsupporting

confidence: 92%

“…The G. intestinalis assemblage B human and cattle samples in the present study were asymptotic to those with the serial nos. KF843922.1 registered in Colombia [ 23 ], LC430549.1 registered in Zambia [ 24 ], AY228628.1 registered in Japan [ 49 ], and KY444789 registered in Iran [ 50 ]. This dimension of the phylogenetic analysis refers to the difference in the nitrogen base successions between the local sample of humans and cattle and those registered globally.…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Prevalence and molecular characterization of Giardia intestinalis isolated from children and calves in Babylon province, Iraq

Alseady,

Al-Dabbagh,

Marhash

2023

Vet World

View full text Add to dashboard Cite

Background and Aim: Giardia intestinalis is one of the most prevalent intestinal parasites in humans and animals, and children in close contact with livestock are particularly at risk of infection. This study aimed to detect assemblages of G. intestinalis and determine the origin of zoonotic transmission of Giardia in children and calves in different parts of Babylon province, Iraq. Materials and Methods: One hundred stool samples from children (68 boys and 32 girls) and 100 fecal samples from calves (46 males and 54 females) of different ages were randomly collected. Molecular techniques were used to estimate the prevalence of G. intestinalis in children and calves. A nested polymerase chain reaction (PCR) was performed by targeting the triose phosphate isomerase gene in the samples to detect G. intestinalis assemblages. Results: The overall rates of infection with G. intestinalis in children and calves were 21% and 34%, respectively, using the conventional microscopic method. The results illustrated that 61.90% (13/21) and 38.09% (8/21) of positive samples from children were allocated to assemblages A and B, respectively (p > 0.05). In calves, assemblages A and B were detecte in 82.35% (28/34) and 17.64% (6/34) of positive samples from calves, respectively (p ≤ 0.001). Ten PCR products were sequenced and submitted to the GenBank database. Phylogenetic analysis detected five human sequences each belonging to G. intestinalis assemblages A (OM850335–OM850339) and B (OM850340–OM850344). Similarly, five calf sequences each belonged to G. intestinalis assemblages A (ON75756–ON757660) and B (ON757661–ON757665). Conclusion: The detection of large numbers of G. intestinalis assemblage A in both humans and cattle indicated that cattle could be a main source of zoonotic G. intestinalis infection in children in Babylon province, Iraq. Keywords: assemblages, calves, children, Giardia intestinalis, nested polymerase chain reaction, triose phosphate isomerase, prevalence.

show abstract

Section: Discussionsupporting

confidence: 92%

Section: Discussionmentioning

confidence: 99%

Prevalence and molecular characterization of Giardia intestinalis isolated from children and calves in Babylon province, Iraq

Alseady,

Al-Dabbagh,

Marhash

2023

Vet World

View full text Add to dashboard Cite

show abstract

“…(2017) ; Jerez Puebla et al. (2017) ; Kashinahanji et al. (2019) Secondary: AL3544 Secondary: AL3545 CCCTTCATCGGIGGTAACTT GTGGCCACCACICCCGTGCC 532 Assemblage A-specific primers Af Ar CGCCGTACACCTGTCA AGCAATGACAACCTCCTTCC 332 (A) Assemblage B-specific primers Bf Br GTTGTTGTTGCTCCCTCCTTT CCGGCTCATAGGCAATTACA 400 (B) tpi Semi-nested PCR and sequencing Primary: tpi1f Primary: tpi479r CCCTTCATCGGYGGTAAC CCCGTGCCRATRGACCACAC – A (AI, AII) & B (BIII, BIV) Breathnach et al.…”

Section: Molecular Tools For Genetic Characterisation Of G ...mentioning

confidence: 99%

“…Twenty-three samples were successfully genotyped ( n = 23) gdh, tpi Assemblage A (78%) Assemblage B (22%) No significant association was observed between assemblages and clinical manifestations. Kashinahanji et al. (2019) Malaysia Indigenous individuals living in village communities ( n = 42) SSU-rRNA Assemblage A (2%) Assemblage B (98%) Two times more likely to have diarrhoea, abdominal pain, vomiting and nausea with an assemblage B infection (OR = 2.4; P = 0.019).…”

Section: Molecular Tools For Genetic Characterisation Of G ...mentioning

confidence: 99%

The controversies surrounding Giardia intestinalis assemblages A and B

Zajaczkowski

Lee

Fletcher-Lartey

et al. 2021

Current Research in Parasitology & Vector-Borne Diseases

View full text Add to dashboard Cite

“…To the best of our knowledge, this is the first study conducted on G. duodenalis -infected individuals in Tehran, Iran, using MLST. However, the overwhelming majority of studies in Iran have reported the molecular characterization of G. duodenalis isolates based on the analysis of one locus ( 21 – 26 , 42 , 43 ) or two loci of gdh and tpi ( 44 – 46 ) or gdh and bg ( 47 ). The MLG data was reported for two Giardia isolates in the only multilocus analysis in southwestern Iran ( 48 ).…”

Section: Discussionmentioning

confidence: 99%

Multilocus sequence typing of Giardia duodenalis genotypes circulating in humans in a major metropolitan area

et al. 2022

View full text Add to dashboard Cite

Giardia duodenalis is an intestinal protozoan parasite of humans and animal hosts and comprises eight microscopically indistinguishable molecularly-diverse lineages designated as assemblages A–H. Assemblages A and B are the primary sources of infections in humans and a wide range of mammals. Here, we identified assemblages, and inter-/intra-assemblage genetic diversity of human G. duodenalis isolates based on the multilocus sequence typing of the triosephosphate isomerase (tpi), β -giardin (bg), and glutamate dehydrogenase (gdh) loci. Multilocus sequence analysis of 62 microscopically-positive G. duodenalis fecal samples identified 26 (41.9%), 27 (43.5%), and nine (14.5%) isolates belonging to assemblages A, B, and discordant assemblages, respectively. The tpi locus assemblage-specific primers identified dual infections with A and B assemblages (45.2%). The sequence analysis of multiple alignments and phylogenetic analysis showed low genetic polymorphism in assemblage A isolates, classified as sub-assemblage AII at three loci, subtype A2 at tpi and gdh loci, and subtype A2 or A3 at bg locus. High genetic variations were found in assemblage B isolates with 14, 15, and 23 nucleotide patterns at tpi, bg, and gdh loci, respectively. Further concatenated sequence analysis revealed four multilocus genotypes (MLG) in 24 assemblages A isolates, two previously-identified (AII-1 and AII-5), with one novel multilocus genotype. However, the high genetic variations observed in assemblage B isolates among and within the three genetic loci prevented the definitive designation of specific MLGs for these isolates. Multilocus sequence typing may provide new insight into the genetic diversity of G. duodenalis isolates in Tehran, suggesting that humans are likely a potential source of G. duodenalis infection. Further host-specific experimental transmission studies are warranted to elucidate the modes of transmission within multiple host populations.

show abstract

Giardia lamblia assemblages A and B isolated from symptomatic and asymptomatic persons in Hamadan, west of Iran

Cited by 11 publications

References 31 publications

Prevalence and molecular characterization of Giardia intestinalis isolated from children and calves in Babylon province, Iraq

Prevalence and molecular characterization of Giardia intestinalis isolated from children and calves in Babylon province, Iraq

The controversies surrounding Giardia intestinalis assemblages A and B

Multilocus sequence typing of Giardia duodenalis genotypes circulating in humans in a major metropolitan area

Contact Info

Product

Resources

About