GH–IGF system regulation of attenuated muscle growth and lipolysis in Atlantic salmon reared at elevated sea temperatures

Abstract

Growth regulation in adult Atlantic salmon (1.6 kg) was investigated during 45 days in seawater at 13, 15, 17, and 19 °C. We focused on feed intake, nutrient uptake, nutrient utilization, and endocrine regulation through growth hormone (GH), insulin-like growth factors (IGF), and IGF-binding proteins (IGFBP). During prolonged thermal exposure, salmon reduced feed intake and growth. Feed utilization was reduced at 19 °C after 45 days compared with fish at lower temperatures, and body lipid storage was depleted with increasing water temperature. Although plasma IGF-1 concentrations did not change, 32-Da and 43-kDa IGFBP increased in fish reared at ≤17 °C, and dropped in fish reared at 19 °C. Muscle igf1 mRNA levels were reduced at 15 and 45 days in fish reared at 15, 17, and 19 °C. Muscle igf2 mRNA levels did not change after 15 days in response to increasing temperature, but were reduced after 45 days. Although liver igf2 mRNA levels were reduced with increasing temperatures after 15 and 45 days, temperature had no effect on igf1 mRNA levels. The liver igfbp2b mRNA level, which corresponds to circulating 43-kDa IGFBP, exhibited similar responses after 45 days. IGFBP of 23 kDa was only detected in plasma in fish reared at 17 °C, and up-regulation of the corresponding igfbp1b gene indicated a time-dependent catabolic response, which was not observed in fish reared at 19 °C. However, higher muscle ghr mRNA levels were detected in fish at 17 and 19 °C than in fish at lower temperatures, indicating lipolytic regulation in muscle. These results show that the reduction of muscle growth in large salmon is mediated by decreased igf1 and igf2 mRNA levels in addition to GH-associated lipolytic action to cope with prolonged thermal exposure. Accordingly, 13 °C appears to be a more optimal temperature for the growth of adult Atlantic salmon at sea.

Transcriptional responses to temperature and low oxygen stress in Atlantic salmon studied with next-generation sequencing technology

“…To do so we obtained samples from two independent experiments, one temperature stress experiment conducted in 2009 and described by Hevrøy et al [30], and one low oxygen stress experiment conducted in 2011. Global transcriptional profiling data were obtained from four cDNA libraries sequenced with 454 FLX technology.…”

Atlantic salmon fed a nutrient package of surplus methionine, vitamin B12, folic acid and vitamin B6 improved growth and reduced the relative liver size, but when in excess growth reduced

“…Reverse transcription followed by quatitative real‐time PCR (RT‐qPCR) as earlier described (Skjaerven, Olsvik, Finn, Holen, & Hamre, ). In liver, MGAT2 and DGAT1 (for primer sequence see: Liland et al, ) and ApoB100 and CD36 (for primer sequence see: Espe, Xie, Chen, Araujo, & Holen, ), and MAT (forward primer: GCTGCTGTGTGGAGAGATCA, reverse primer: TGGTCTCCAGCTCCCATATC) and CBS (forward primer: AAACCCTCAGACCCAGTCAA, reverse primer: CTCTTCTCCCTGGCTGTGAC) were addressed, while in muscle growth hormone receptor (GHr), insulin‐like growth factor 1 (IGF‐1) and IGF‐1 receptor (IGF‐1r) were analysed (for primer sequence see: Hevrøy et al, ). The obtained c t values were normalized against two reference genes, b‐actin and EF1a (for primer sequence see: Espe et al, ).…”

“…Quality and quantity of RNA were analysed as described elsewhere (Espe et al, 2014). Reverse transcription followed by quatitative real-time PCR (RT-qPCR) as earlier described (Skjaerven, Olsvik, Finn, Holen, & Hamre, 2011 CTCTTCTCCCTGGCTGTGAC) were addressed, while in muscle growth hormone receptor (GHr), insulin-like growth factor 1 (IGF-1) and IGF-1 receptor (IGF-1r) were analysed (for primer sequence see: Hevrøy et al, 2013). The obtained c t values were normalized against two reference genes, b-actin and EF1a (for primer sequence see: Espe et al, 2019).…”

Role of the GH-IGF-1 system in Atlantic salmon and rainbow trout postsmolts at elevated water temperature

“…In the current experiment the somatic length growth of salmon and rainbow trout was impaired at an elevated temperature of 19°C, while no effects were observed on body mass, feed intake or feed utilization in either species. In larger Atlantic salmon Hevrøy et al (2012Hevrøy et al ( , 2013 documented reduced growth after 2-3 weeks, indicating that smaller fish, as the current postsmolts, cope with elevated temperatures better than larger salmon (N 1.6 kg). However, we detected a reduction of SGR in Atlantic salmon kept at 19°C between day 15 and day 35 which may have induced body mass differences if the study had lasted longer than 35 days.…”