Genotyping ofOchrobactrum anthropibyrecA-based comparative sequence, PCR-RFLP, and 16S rRNA gene analysis

Abstract

A recA-PCR restriction fragment length polymorphism assay was developed to study intraspecies variation among Ochrobactrum anthropi. Primers deduced from the known recA gene sequence of the genetically closely related genus Brucella allowed the specific amplification of a 1065 bp recA fragment from each of the 38 O. anthropi and the eight Brucella strains investigated. RecA was also amplified from the type strains of O. intermedium, O. tritici, and O. lupini but could not be generated from O. grignonense and O. gallinifaecis. Subsequent comparative recA sequence- and HaeIII-recA restriction fragment length polymorphism analysis identified nine different genospecies among the tested 38 O. anthropi isolates, whereas the recA sequences of the Brucella spp. were indistinguishable. Furthermore, Brucella spp., O. anthropi, O. intermedium, and O. tritici were clearly separated from each other by means of their recA sequences and HaeIII restriction patterns. Five strains of uncertain species status listed in the Culture Collection University of Göteborg bacterial culture collection as O. anthropi were characterized by recA analysis, and their phylogenetic position within the Brucella-Ochrobactrum group was determined. In summary, recA-sequence analysis provides a new reliable molecular subtyping tool to study the phylogeny of the Ochrobactrum taxon at both the inter- and intraspecies level.

Brucella ceti sp. nov. and Brucella pinnipedialis sp. nov. for Brucella strains with cetaceans and seals as their preferred hosts

“…Both copies of the omp2 gene were shown to contain motifs typical of marine mammal isolates. 16S rRNA gene sequence data, as well as recA gene sequences, identify the strains from marine mammals as belonging to the genus Brucella (Scholz et al, 2006).…”

Pseudochrobactrum lubricantis sp. nov., isolated from a metal-working fluid

“…The 16S rRNA gene-based tree shown in Fig. 1 results from a neighbour-joining reconstruction using the Kimura two-parameter correction and 1000 resamplings for bootstrap analysis.The partial recA sequence of strain KSS 7.8 T was analysed as described previously (Scholz et al, 2006). The PCR was performed with primers RecA-PsOchro-f (59-AAGGCTC-TGGACGCGGCACT-39) and RecA-PsOchro-r (59-CGC-AAGGTCAGTTC AATCTCAT-39).…”

“…The partial recA sequence of strain KSS 7.8 T was analysed as described previously (Scholz et al, 2006). The PCR was performed with primers RecA-PsOchro-f (59-AAGGCTC-TGGACGCGGCACT-39) and RecA-PsOchro-r (59-CGC-AAGGTCAGTTC AATCTCAT-39).…”

Difficulty in the identification and differentiation of clinically relevant Ochrobactrum species

“…at the inter-and intraspecies level (Scholz et al, 2006) confirmed isolate RMA 16449 as O. intermedium (results not shown).…”

“…Hence isolate RMA 16994 appeared to be more closely related to O. intermedium than to O. anthropi. Identification of isolate RMA 16994 as O. intermedium was confirmed by the presence of the O. intermedium-specific sequence motifs ggctaat and ggttagtggagacactatcc at positions nt 487-493 and nt 905-924 of the 1390 bp 16S rRNA gene fragment as described by Scholz et al (2006). The second motif is also shared with Brucella spp.…”