Genome‐wide identification of suitable zebrafish Danio rerio reference genes for normalization of gene expression data by RT‐qPCR

Abstract

In this study, to systematically identify the most stably expressed genes for internal reference in zebrafish Danio rerio investigations, 37 D. rerio transcriptomic datasets (both RNA sequencing and microarray data) were collected from gene expression omnibus (GEO) database and unpublished data, and gene expression variations were analysed under three experimental conditions: tissue types, developmental stages and chemical treatments. Forty-four putative candidate genes were identified with the c.v. <0·2 from all datasets. Following clustering into different functional groups, 21 genes, in addition to four conventional housekeeping genes (eef1a1l1, b2m, hrpt1l and actb1), were selected from different functional groups for further quantitative real-time (qrt-)PCR validation using 25 RNA samples from different adult tissues, developmental stages and chemical treatments. The qrt-PCR data were then analysed using the statistical algorithm refFinder for gene expression stability. Several new candidate genes showed better expression stability than the conventional housekeeping genes in all three categories. It was found that sep15 and metap1 were the top two stable genes for tissue types, ube2a and tmem50a the top two for different developmental stages, and rpl13a and rp1p0 the top two for chemical treatments. Thus, based on the extensive transcriptomic analyses and qrt-PCR validation, these new reference genes are recommended for normalization of D. rerio qrt-PCR data respectively for the three different experimental conditions.

HuD and the Survival Motor Neuron Protein Interact in Motoneurons and Are Essential for Motoneuron Development, Function, and mRNA Regulation

“…Two different guide RNAs were designed and used to target zebrafish HuD exon 3, using protocols based on Talbot and Amacher (2014); for mutagenesis, guide RNAs were coinjected with nuclear localized Cas9 (Jao et al, 2013) HuD CRISPR target 1 is GGGGCAGGTAGTTGACGATG at the end of HuD exon3. We designed a guide oligo sequence, including a Cas9 binding scaffold, CRISPR target, and T7 promoter as follows: AAA GCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGC CTTATTTTAACTTGCTATTTCTAGCTCTAAAACCATCGTCAA CTACCTGCCCCTATAGTGAGTCGTATTACGC.…”

“…For CRISPR mutagenesis, Cas9 mRNA was synthesized from pCS2-nCas9n (Jao et al, 2013) using mMessage mMachine Sp6 kit (Invitrogen). The gRNA (40 ng/l) and cas9 mRNA (80 ng/l) were mixed together, and 1 nl was injected into 1 cell stage embryos.…”

“…If SMN and HuD are affecting mRNA, then we would expect to see an alteration in a HuD target mRNA. Gap43 is a neural-specific phosphoprotein, enriched in growth cones and involved in neural development, regeneration, and plasticity (Meiri et al, 1986;Benowitz and Routtenberg, 1987). Localized translation of Gap43 mRNA in axons is important for axonal growth .…”

“…RBPs have been shown to function in transporting mRNAs to axons and dendrites during development and regeneration after injury (Holt and Schuman, 2013;Hörnberg and Holt, 2013). For example, limiting the amount of the RBP ZBP1 decreases the levels of axonal mRNAs and negatively affects regeneration after injury , and mouse knockdown of the RBP IMP2 resulted in disruption of commissural axon pathfinding in vivo (Preitner et al, 2016). Locally translated RNAs affect both axonal branching and elongation of regenerating axons, supporting a critical role for RBPs and their mRNA cargos in regeneration and function .…”

“…Using a genetic zebrafish model expressing no zebrafish SMN and only low levels of human SMN (hereafter referred to as mz-smn mutants), we found that motoneurons are born and take on the correct fates but fail to form robust axons with the normal level of branching, and their dendrites are reduced in number and length . We and others have shown that neuromuscular junction (NMJ) formation is also affected under conditions of low SMN (Kariya et al, 2008;Boon et al, 2009;Kong et al, 2009;Ling et al, 2012). In the context of the disease spinal muscular atrophy (SMA), which is caused by low levels of SMN, we have hypothesized that this abnormal development generates a motoneuron that will eventually fail to function.…”