Genome-wide analysis of repressor element 1 silencing transcription factor/neuron-restrictive silencing factor (REST/NRSF) target genes

Abstract

The completion of whole genome sequencing projects has provided the genetic instructions of life. However, whereas the identification of gene coding regions has progressed, the mapping of transcriptional regulatory motifs has moved more slowly. To understand how distinct expression profiles can be established and maintained, a greater understanding of these sequences and their trans-acting factors is required. Herein we have used a combined in silico and biochemical approach to identify binding sites [repressor element 1͞neuron-restrictive silencer element (RE1͞NRSE)] and potential target genes of RE1 silencing transcription factor͞neu-ron-restrictive silencing factor (REST͞NRSF) within the human, mouse, and Fugu rubripes genomes. We have used this genomewide analysis to identify 1,892 human, 1,894 mouse, and 554 Fugu RE1͞NRSEs and present their location and gene linkages in a searchable database. Furthermore, we identified an in vivo hierarchy in which distinct subsets of RE1͞NRSEs interact with endogenous levels of REST͞NRSF, whereas others function as bona fide transcriptional control elements only in the presence of elevated levels of REST͞NRSF. These data show that individual RE1͞NRSE sites interact differentially with REST͞NRSF within a particular cell type. This combined bioinformatic and biochemical approach serves to illustrate the selective manner in which a transcription factor interacts with its potential binding sites and regulates target genes. In addition, this approach provides a unique whole-genome map for a given transcription factor-binding site implicated in establishing specific patterns of neuronal gene expression.

Functional significance of repressor element 1 silencing transcription factor (REST) target genes in pancreatic beta cells

“…ac.uk/cgi-bin/RE1db/nrse.cgi) [7], the following putative targets: (1) the gene encoding the soluble N-ethylmaleimidesensitive factor attachment protein receptor (SNARE) protein SNAP25, which contains two consecutive RE-1s, referred to as RE-1.1 and RE-1.2 [7]; (2) the genes encoding the members of the Ca 2+ sensor synaptotagmin family SYT II, SYT IV, SYT VI, SYT VII, SYT IX; and (3) the genes coding for the N-ethylmaleimide-sensitive factor (NSF), for UNC-18 homologue 1 (MUNC-18-1) and for complexin II, which participate in the formation and stabilisation of the SNARE complex. The 21 bp human RE-1 sequences associated to these genes were compared with those of consensus RE-1 and of the known CX36 RE-1 [11].…”

“…However, increasing evidence suggests that the significance of the REST/RE-1 system is diverse in embryonic and adult cells and depends on the range of target genes that REST interacts with. Accordingly, a bioinformatic analysis recently revealed about 1,800 putative REST target genes within the human genome, with attributed roles ranging from transcriptional regulation through to metabolism and various aspects of neuronal function [7]. Previous reports have identified some of these target genes and their function in and outside the nervous system.…”

Regulation of the NRSF/REST gene by methylation and CREB affects the cellular phenotype of small-cell lung cancer

“…As siRNA-mediated knockdown of NRSF/ REST correlated with increased AKT phosphorylation (Westbrook et al, 2005), we analysed genomic sequences of AKT pathway members for the presence of NRSEs. On analysing the 3 0 untranslated region of the AKT2 gene, a putative NRSE was confirmed, 15 kb from the transcription start site (Bruce et al, 2004). This NRSE of AKT2 (ATCAGCACCGGGGACAGCGCG) showed high similarity to the core sequence (TTCAG CACCACGGACAGCGCC) (Schoenherr and Anderson, 1995).…”

“…As NRSEs were identified for the rat SCG10 and other neuronal genes, NRSF was initially regarded as a master negative regulator of neurogenesis (Schoenherr and Anderson, 1995). Indeed, the number of putative NRSF/REST-regulated genes has dramatically risen since (Bruce et al, 2004). A recent study showed that the canonical 21-bp consensus sequence of NRSE represents a subgroup of an even larger set of NRSEs, which also contains elements compressed by 1-2 bp and those extended by 3-9 bp (Otto et al, 2007).…”

Epigenetics in development

“…To address the latter part of the question, PcG, is normally (but not always) associated with silenced genes (stem cells provide an interesting exception) whereas our studies (Belyaev et al, 2004;Bruce et al, 2004;Greenway et al, 2006) show that REST is normally associated with active genes, i.e., employment of REST can maintain repression of an otherwise active gene, whereas in the differentiated state, PcG normally acts to establish and/or maintain silence. G.C.…”