Genetic transformation of gentian Gentiana tibetica (King) leaf explants with Agrobacterium tumefaciens strain C58C1

Wójcik, Anna; Rybczyński, Jan J.

doi:10.1007/s11738-016-2327-z

Cited by 3 publications

(3 citation statements)

References 59 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…5N!GAGGCTATTCGGCTATGACTG!3N and 5N!ATCGG GAGCGGCGATACCGTA!3N, respectively; these primers amplified a fragment of 700 bp (Wójcik and Rybczyński, 2017). The thermal profile adopted for PCR was as follows: pre-denaturation at 95EC for 15 min, followed by 30 cycles of denaturation at 94EC for 30 sec, annealing at 56EC for 30 sec, and elongation at 72EC for 60 sec; this was followed by a final extension at 72EC for 5 min and a pause at 4EC.…”

Section: Pcr Analysis Of Transgenesismentioning

confidence: 99%

“…In the case of leaf blade explants of Gentiana cruciata, L-glutamine was used as an essential factor for obtaining callus tissue and ensuring stable transformation. The highest number of T0 plants was regenerated in the presence of 1 g @ l !1 L-glutamine (Wójcik and Rybczyński, 2017). Based on our experience with vector (Wójcik and Rybczyński, 2017) and nonvector (Wójcik and Rybczyński, 2015) transformations of gentians, complexes of (mitotically active) embryogenic cells were selected for the experiments conducted in the present study to test the effect of L-glutamine on transformation efficiency and maintenance of embryogenic potential.…”

mentioning

confidence: 99%

“…The highest number of T0 plants was regenerated in the presence of 1 g @ l !1 L-glutamine (Wójcik and Rybczyński, 2017). Based on our experience with vector (Wójcik and Rybczyński, 2017) and nonvector (Wójcik and Rybczyński, 2015) transformations of gentians, complexes of (mitotically active) embryogenic cells were selected for the experiments conducted in the present study to test the effect of L-glutamine on transformation efficiency and maintenance of embryogenic potential. Thus, the aim of this study was to investigate the effects of L-glutamine on the efficiency of Agrobacterium -mediated transformation of the established cell suspensions of three gentian species, namely G. cruciata, Gentiana kurroo, and Gentiana lutea.…”

mentioning

confidence: 99%

See 2 more Smart Citations

The effect of L-glutamine on the genetic transformation of embryogenic cell suspensions of gentian species (Gentiana lutea L., Gentiana cruciata L., and Gentiana kurroo Royle) using Agrobacterium tumefaciens

Rybczyński

Wójcik

2019

bta

Self Cite

View full text Add to dashboard Cite

In this study, established embryogenic cell suspensions of three gentian species, Gentiana cruciata L., Gentiana kurroo Royle, and Gentiana lutea L., cultured in the presence of two media CMS1 and CMS2, were used to determine the effect of L-glutamine on the efficiency of Agrobacterium tumefaciens-mediated transformation. The presence of 1 g @ l !1 glutamine in the co-cultivation medium and a 48-hr co-cultivation period were found to be optimal for all the cultures investigated. In order to regenerate plants in the post-transformation culture, approximately 100 mg of cell aggregates was plated as a single layer on RM1 and RM2 media. Timentin was used in posttransformation cultures for preventing bacterial contamination and enhancing cell viability. The transformants were selected in the presence of 50 mg @ l !1 kanamycin. Transformation was later confirmed by histochemical analysis of the activity of reporter enzyme (β-glucuronidase) and by polymerase chain reaction for the detection of uidA and nptII genes. Five lines of embryogenic cell suspension cultures of the studied species were selected and grown in the presence of 50 mg @ l !1 kanamycin. Finally, 23 embryos were regenerated, of which only 11 converted into T0 transformants of G. cruciata. These transformants continued to grow in the presence of kanamycin. A solid, dark blue coloration of their leaves confirmed stable integration and expression of the uidA gene. The molecular analysis of T0 plants revealed the absence of bacterial contamination. Thus, the short list of plant species that can be transformed by A. tumefaciens with the help of an embryogenic cell suspension is extended by the three species investigated in this study.

show abstract

Section: Pcr Analysis Of Transgenesismentioning

confidence: 99%

mentioning

confidence: 99%

mentioning

confidence: 99%

See 1 more Smart Citation