Genetic Monitoring of Crimean-Congo Hemorrhagic Fever Virus in the South of the European Part of Russia

Abstract

Presented are the results of gene-typing of CCHF virus detected in clinical samples from CHF patients from the Stavropol, Rostov and Astrakhan Regions in 2011. For 28 samples determined are nucleotide sequences of the fragments 115–652 (S segment) and fragments 984–1469 (M segment). Philogenetic analysis of these nucleotide sequences demonstrated that typical strains circulated in 2011 in the regions under surveillance, importation of the new genetic variants of the virus did not take place. CCHF virus variant affiliated to the subgroup “Astrakhan-2” was detected in the clinical samples for the first time and characterized for its genome S- and M-segment fragments.

Molecular epidemiology of Crimean-Congo hemorrhagic fever virus in Russia

“…Fragments of the S, M and L segments were amplified using the primer pairs S 100f and S 680r [ 18 ]; 24 and 25 [ 23 ]; and L100f: gattggactcaggtgattgctggtc and L540r: gcctccctcgtgtctgtttc, respectively. The purification of the PCR products was carried out using the AxyPrep™ PCR Cleanup Kit (Axygen Biosciences, USA).…”

“…The phylogenetic analysis of partial S segment sequences allows several subgroups within lineage Europe 1 to be separated. Russian CCHFV strains belong to three subgroups: Stavropol-Rostov-Astrakhan (Va), Volgograd-Rostov-Stavropol (Vb), Astrakhan-2 (Vc), and Crimea (Vd) [ 16 , 18 , 19 ]. Strains from the Balkans and Turkey form distinct subgroups [ 20 – 22 ].…”