Genetic Characterization of a Novel Mutant of Peste Des Petits Ruminants Virus Isolated fromCapra ibexin China during 2015

Abstract

Peste des petits ruminants virus (PPRV) is the causative agent of peste des petits ruminants (PPR). The spread of PPR often causes severe economic losses. Therefore, special attention should be paid to the surveillance of PPR emergence, spread, and geographic distribution. Here we describe a novel mutant of PPRV China/XJBZ/2015 that was isolated from Capra ibex in Xinjiang province in China 2015. The sequence analysis and phylogenetic assessment indicate that China/XJBZ/2015 belongs to lineage IV, being closely related to China/XJYL/2013 strain. Interestingly, the V protein sequence of China/XJBZ/2015 showed lower homology with other Chinese PPRVs isolated during 2013 to 2014 (94%~95%), whereas it shared 100% identity with three Tibet strains isolated in China 2007. The 3′ UTR, V gene, and C gene were determined to be highly variable. Besides, 29 PPR genomic sequences available in GenBank were analyzed in this study. It is the first time to use PPRV genomic sequences to classify the different lineages which confirmed the lineage clustering of PPRVs using N gene 255 bp fragments and F gene 322 bp fragments. In conclusion, our findings indicate that the PPRVs continue to evolve in China, and some new mutations have emerged.

A comprehensive global perspective on phylogenomics and evolutionary dynamics of Small ruminant morbillivirus

“…A diverse nucleotide hotspot was obsereved between 5ʹ UTR of M and 3ʹ UTR of the F genes in the whole genome. This aligns with observations made previously where a hotspot was identified at similar position between M and F genes 14 , highlighting potential variations in the genome size and corresponding substitutions 43 in each of the gene. An influence of these spontaneous mutations in genome was assessed by employing Tajima's D statistics that showed a non-significant negative value for all coding genes in DnaSP analysis, suggesting a lack of influence of spontaneous mutations on the fitness of individual virus.…”

Emergence of novel Seneca Valley virus strains in China, 2017

“…As for VP1 amino acids comparison, these isolates shared the highest similarity 99.6% with CH‐02‐2015 and CH‐03‐2015 that were isolated in 2015 in China, and showed 98.1%–99.2% similarity with other strains previously reported in China, but 99.2% with KS15‐01 strain. Forty SVV VP1 genes available in GenBank and the seven VP1 sequences from our collection were further used to construct the phylogenetic tree as previously described (Zhu et al., ). The analysis placed the seven outbreak strains in the same clade as the US strain KS15‐01, indicating that they were closely related to KS15‐01 but distantly related to the previous Chinese strains (Figure ).…”

First report of peste des petits ruminants virus lineage II in Hydropotes inermis , China

“…Total RNA was resuspended in 25 μl of nuclease‐free water, and 5 μl was used to synthesize the cDNA fragments. PPRV was detected by reverse transcription polymerase chain reaction (RT‐PCR) using specific primers (forward: 5′‐ACAGGCGCAGGTCTCCTTCCT‐3′ and reverse: 5′‐CACTGATTTCGACAGAGGGTG‐3′) for the PPRV N gene (Zhu et al., ). The amplification cycle consisted of an initial denaturation at 94°C for 5 min, followed by 35 cycles of 94°C for 30 s, 55°C for 45 s and 72°C for 1 min.…”