Genetic and serological analysis of the immunogenic 67-kDa lipoprotein of Mycoplasma sp. bovine group 7

Frey, Joachim; Cheng, Xiaoxing; Monnerat, Marie-Pierre; Abdo, El-Mostafa; Krawinkler, M.; Bölske, Göran; Nicolet, Jacques

doi:10.1016/s0923-2508(97)83624-8

Cited by 26 publications

(20 citation statements)

References 16 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…bovine group 7 from various origins and clinical contexts (for details, see Table 2). These clones were identified by the method of dot immunobinding on membrane filtration (MF-dot) with specific rabbit antisera (23), by the analysis of a segment of their 16S rRNA (8,21), fusA (13), and rpoB (26) genes, and by the PCR assays performed as previously published (7,16,17,20 SSH and construction of subtracted libraries. SSH was performed as previously described using the RN48 (5Ј-AGCACTCTCCAGCCTCTCACCGAGA GGCAACTGTGCTATCCGAGGGAG) and RJ48 (5Ј-AGCACTCTCCAGCC TCTCACCGAGACCGACGTCGACTATCCATGAACG) adapters (15).…”

Section: Methodsmentioning

confidence: 99%

Suppression-Subtractive Hybridization as a Strategy To Identify Taxon-Specific Sequences within the Mycoplasma mycoides Cluster: Design and Validation of an M. capricolum subsp. capricolum -Specific PCR Assay

Maigre¹,

Citti

Marenda

et al. 2008

J Clin Microbiol

View full text Add to dashboard Cite

The phylogenetically related Mycoplasma capricolum subsp. capricolum and M. mycoides subsp. mycoides biotype Large Colony are two small-ruminant pathogens involved in contagious agalactia. Their respective contributions to clinical outbreaks are not well documented, because they are difficult to differentiate with the current diagnostic techniques. In order to identify DNA sequences specific to one taxon or the other, a suppression-subtractive hybridization approach was developed. DNA fragments resulting from the reciprocal subtraction of the type strains were used as probes on a panel of M. capricolum subsp. capricolum and M. mycoides subsp. mycoides biotype Large Colony strains to assess their intrataxon specificity. Due to a high intrataxon polymorphism and important cross-reactions between taxa, a single DNA fragment was shown to be specific for M. capricolum subsp. capricolum and to be present in all M. capricolum subsp. capricolum field isolates tested in this study. A PCR assay targeting the corresponding gene (simpA51) was designed that resulted in a 560-bp amplification only in M. capricolum subsp. capricolum and in M. capricolum subsp. capripneumoniae (the etiological agent of contagious caprine pleuropneumonia). simpA51 was further improved to generate a multiplex PCR (multA51) that allows the differentiation of M. capricolum subsp. capripneumoniae from M. capricolum subsp. capricolum. Both the simpA51 and multA51 assays accurately identify M. capricolum subsp. capricolum among other mycoplasmas, including all members of the M. mycoides cluster. simpA51 and multA51 PCRs are proposed as sensitive and robust tools for the specific identification of M. capricolum subsp. capricolum and M. capricolum subsp. capripneumoniae.The Mycoplasma genus is composed of wall-less bacteria with small genomes (0.58 to 1.35 Mb) and includes several species known to cause important diseases in humans and animals (24). Most of these species can be grown under laboratory conditions, although they require complex, undefined media and several days to several weeks of incubation because of their limited biosynthetic capacities (24). So far, mycoplasma identification and diagnosis have been based mainly on serological assays after cultivation, but recent ongoing efforts have been directed toward replacing these assays with more rapid and accurate molecular approaches based on the detection of specific DNA sequences.For the veterinary field, members of the so-called Mycoplasma mycoides cluster are of particular concern, because they are important ruminant pathogens that are responsible for economic losses worldwide (1, 28). This cluster includes six taxa, which are phylogenetically closely related based on their 16S rRNA gene sequences (21); present similar serological patterns associated with important intertaxon cross-reactivity (12); and, consequently, are difficult to differentiate. Four taxa contain pathogens for small ruminants, with three, namely, M. mycoides subsp. mycoides biotype Large Colony, M. mycoides subsp. capri,...

show abstract

Section: Methodsmentioning

confidence: 99%

Suppression-Subtractive Hybridization as a Strategy To Identify Taxon-Specific Sequences within the Mycoplasma mycoides Cluster: Design and Validation of an M. capricolum subsp. capricolum -Specific PCR Assay

Maigre¹,

Citti

Marenda

et al. 2008

J Clin Microbiol

View full text Add to dashboard Cite

show abstract

“…But classifying the members of M. mycoides cluster has always been problematic: (i) Extensive and complex cross-reactions occur between subspecies or types, and acute antigenic identification of CBPP and CCPP agents has been achieved only through the use of specific monoclonal antibodies [4,32]; (ii) High antigenic heterogeneity within some types or subspecies (MmmLC, Mcc) hampers identification [6,18,27]; (iii) The definitive taxonomy of the M. mycoides cluster has not yet been established and discrepancies have recently appeared between their taxonomy and phylogeny. Msp7 strain PG50 produces significant cross-reactions with Mccp and, to some extent, with MmmSC [13,27], and should be phylogenetically included as a subspecies of the M. capricolum species [1,14,26,33]. The 16S rRNA genes of Mmc and MmmLC are 99.9% similar, suggesting they should be considered as two phenotypes of the same species, distinct from MmmSC [21,26]; (iv) Animal host specificity, previously thought as very specific and used as a clue to identification, has proven to be unreliable [23].…”

Section: Introductionmentioning

confidence: 99%

Assessment of PCR for routine identification of species of the Mycoplasma mycoides cluster in ruminants

et al. 2004

View full text Add to dashboard Cite

-DNA amplification techniques offer considerable promise for the identification of Mycoplasma mycoides cluster members. They avoid antigenic cross-reactivity and variability that hamper serological methods. Many sets of primers, specific of these different members and of Mycoplasma putrefaciens, have been proposed. To assess the reliability of some of these PCR tests in routine laboratory diagnostic use, 230 field strains supposed to belong to this group were simultaneously identified by PCR and an antigenic method. The results were well correlated to antigenic identification for M. putrefaciens, but PCR failed to identify respectively 74% and 52% of M. mycoides subsp. mycoides Large Colony type and M. capricolum subsp. capricolum strains. Any identification of M. mycoides subsp. mycoides Small Colony type must be confirmed by two different tests. Difficulties in defining the M. species bovine serogroup 7 were also encountered with both the PCR and immunological methods. The occurrence of putative variable antigen(s) on the mycoplasma surface may explain part of the identification difficulties encountered with the immunological methods. Mycoplasma mycoides cluster / PCR / ruminants / identification / variable antigen

show abstract

“…To date, eight genera belonging to the class Mollicutes have been described, and within these genera, up to 200 species, mostly of the genus Mycoplasma, are acknowledged. This variety of species is associated with several taxonomic ambiguities (15,17,18), and a correct identification may be very difficult for numerous reasons. First, a number of Mollicutes, especially the plant-pathogenic spiroplasmas, have not been cultivated, while others require very complex media.…”

mentioning

confidence: 99%

Evaluation of tRNA Gene PCR for Identification of Mollicutes

et al. 2005

View full text Add to dashboard Cite

We evaluated the applicability of tRNA gene PCR in combination with fluorescent capillary electrophoresis with an ABI310 genetic analyzer (Applied Biosystems, Calif.) for the identification of different mollicute species. A total of 103 strains and DNA extracts of 30 different species belonging to the genera Acholeplasma, Mycoplasma, and Ureaplasma were studied. Reproducible peak profiles were generated for all samples, except for one M. genitalium isolate, the three M. gallisepticum isolates, and 8 of the 24 Ureaplasma cultures, where no amplification could be obtained. Clustering revealed numerous discrepancies compared to the identifications that had been previously obtained by means of biochemical and serological tests. Final identification was obtained by 16S rRNA gene amplification followed by sequence analysis and/or restriction digestion. This confirmed the identification obtained by tRNA gene PCR in all cases. Seven samples yielded an unexpected tRNA gene PCR profile. Sequence analysis of the 16S rRNA genes showed that six of these samples were mixed and that one had a unique sequence that did not match any of the published sequences, pointing to the existence of a not-yet-described species. In conclusion, we found tRNA gene PCR to be a rapid and discriminatory method to correctly identify a large collection of different species of the class of Mollicutes and to recognize not-yet-described groups.Having no cell wall, Mollicutes form a special class of bacteria. Their small, compact genomes evolved from AT-rich, gram-positive bacteria by means of genome reduction. At the same time, they developed innovative mechanisms to survive as parasitic organisms in a wide variety of host environments. To date, eight genera belonging to the class Mollicutes have been described, and within these genera, up to 200 species, mostly of the genus Mycoplasma, are acknowledged. This variety of species is associated with several taxonomic ambiguities (15,17,18), and a correct identification may be very difficult for numerous reasons. First, a number of Mollicutes, especially the plant-pathogenic spiroplasmas, have not been cultivated, while others require very complex media. As a result, for some species, only a limited number of isolates exist, and these are often not easily accessible. Second, as more sequences and better isolation media become available, more species are continuously being discovered. Finally, for some species, limited data and very few reports are published, especially for less-virulent and nonvirulent species.To correctly differentiate all these species, a universal and fast identification technique would be extremely useful. Some promising methods have already been described (see, e.g., reference 25), but they do not yield digitized data, making exchange between laboratories difficult. An optimized tRNA gene PCR technique, originally described by Welsh and McClelland (27,48), has been shown to be useful for correct and reproducible identification of very diverse bacterial species when combined with hig...

show abstract

Genetic and serological analysis of the immunogenic 67-kDa lipoprotein of Mycoplasma sp. bovine group 7

Cited by 26 publications

References 16 publications

Suppression-Subtractive Hybridization as a Strategy To Identify Taxon-Specific Sequences within the Mycoplasma mycoides Cluster: Design and Validation of an M. capricolum subsp. capricolum -Specific PCR Assay

Suppression-Subtractive Hybridization as a Strategy To Identify Taxon-Specific Sequences within the Mycoplasma mycoides Cluster: Design and Validation of an M. capricolum subsp. capricolum -Specific PCR Assay

Assessment of PCR for routine identification of species of the Mycoplasma mycoides cluster in ruminants

Evaluation of tRNA Gene PCR for Identification of Mollicutes

Contact Info

Product

Resources

About