Genetic and Morphological Characterization of Colletotrichum acutatum Causing Anthracnose of Lupins

Abstract

Anthracnose, caused by Colletotrichum sp., is a serious problem of lupins (Lupinus spp.) worldwide. Morphological characters and molecular markers were used to characterize 43 Colletotrichum isolates from lupins, 8 isolates from other hosts, and 18 reference isolates representing related Colletotrichum spp., to assess the pathogen diversity and resolve its taxonomy. All lupin Colletotrichum isolates tested positive with C. acutatum-specific polymerase chain reaction (PCR) and did not test positive with C. gloeosporioides-specific PCR. Spore shape and colony diameter as well as insensitivity to benomyl grouped the lupin anthracnose isolates closer to C. acutatum than to C. gloeosporioides. Analysis of internal transcribed spacer (ITS) sequences of 57 Colletotrichum isolates grouped all lupin isolates with C. acutatum and distinct from C. gloeosporioides. Further, tub2 and his4 sequences revealed groups concordant with ITS, reducing the excessive dependence on the latter. Arbitrarily primed-PCR and amplified fragment length polymorphism analyses revealed intraspecific subgroups, but neither was useful to decipher species level relationships. ITS, tub2, and his4 results strongly support designating lupin anthracnose pathogen as C. acutatum or its subspecies. Most Colletotrichum isolates from lupins from worldwide locations are genetically homogeneous and form a distinct subgroup within C. acutatum. Present results also underline the potential of the C. acutatum-specific PCR for routine pathogen diagnosis.

Genetic diversity and virulence of Colletotrichum lupini isolates collected in Chile

“…Yang & Sweetingham (1998) used the same method for strains of lupin anthracnose, and while it identified the strains as C. acutatum, they preferred traditional taxonomy and instead characterized the strains as C. gloeosporioides by morphology. In contrast, Talhinhas et al (2002) argued that most morphologic characteristics, with the exception of spore morphology and mycelium growth speed, are not adequate for differentiating C. gloeosporioides from C. acutatum. Using these morphological parameters and molecular data, Talhinhas et al (2002) and Sreenivasaprasad & Talhinhas (2005) determined that most of the analyzed lupin anthracnose isolates from around the world belonged to a homogeneous group within C. acutatum.…”

Variabilidade genética de Colletotrichum guaranicola usando marcadores AFLP

“…Duarte et al (1995) (Vós et al 1995) foi utilizada para análises moleculares em diversos microrganismos fitopatogênicos (o`neill et al 1997;talhinhas et al 2002;Peres et al 2003;Dini-andreote et al 2009) permitindo a análise de um grande número de locos por reação com reprodutibilidade dos resultados (Ferreira e Grattapaglia 1996) e pode ser aplicada também a estudos de segregação de genes, visando determinar as bases genéticas e moleculares de fenômenos biológicos em fungos fitopatogênicos, virulência e em estudos taxonômicos (o`neill et al 1997;Silva-Mann et al 2005;Rodrigues 2010).…”

Aplicação de suspensões de Agaricus blazei, Lentinula edodes e de acibenzolar-S-metil na redução da antracnose em frutos de maracujá-azedo

“…Um isolado de C. gloeosporioides foi obtido de lesão em fruto de maracujá-azedo infectado naturalmente, conforme metodologia adotada por . A identificação da espécie foi feita por análises morfológicas, conforme metodologia descrita por Andrade et al (2007), e análise molecular, utilizando o primer TBCG 5' CGGAAGCCTGGGTAGGAGCG 3', específico para C. gloeosporioides, em conjunto com o primer conservado TB5 5' GGTAACCAGATTGGTGCTGCCTT 3´, conforme descrito por Talhinhas et al (2002Talhinhas et al ( , 2005. O fungo foi cultivado em meio batata-dextrose-agar por sete dias e uma suspensão de esporos foi obtida por raspagem de placas de Petri e adição de 10mL de água destilada autoclavada, sendo a concentração (10 6 esporos/mL) ajustada em câmara de Neubauer.…”