Genetic analysis of phenotype in Trypanosoma brucei : a classical approach to potentially complex traits

Abstract

The genome of the African trypanosome, Trypanosoma brucei, is currently being sequenced, raising the question of how the data generated can be used to determine the function of the large number of genes that will be identified. There is a range of possible approaches, and in this paper we discuss the use of a classical genetic approach coupled with positional cloning based on the ability of trypanosomes to undergo genetic exchange. The genetics of these parasites is essentially similar to a conventional diploid Mendelian system with allelic segregation and an independent assortment of markers on different chromosomes. Data are presented showing that recombination occurs between markers on the same chromosome allowing the physical size of the unit of recombination to be determined. Analysis of the available progeny clones from a series of crosses shows that, in principal, large numbers of progeny can readily be isolated from existing cryopreserved products of mating and, taking these findings together, it is clear that genetic mapping of variable phenotypes is feasible. The available phenotypes for analysis are outlined and most are relevant to the transmission and pathogenesis of the parasite. Genetic maps from two crosses are presented based on the use of the technique of AFLP; these maps comprise 146 and 139 markers in 30 and 21 linkage groups respectively. Segregation distortion is exhibited by some of the linkage groups and the possible reasons for this are discussed. The general conclusion, from the results presented, is that a genetic-mapping approach is feasible and will, in the future, allow the genes determining a number of important traits to be identified.

Characterization of components of the mismatch repair machinery in Trypanosoma brucei

“…In contrast, in the two MSH2 –/– cell lines, four of the five loci showed repeat length changes in at least one allele from the 10 clones examined and, in some cases, half or more of the alleles had changed size. The one locus that displayed no microsatellite instability in the MSH2 –/– cells, ChrII‐6 (Tait et al ., 2002; El Sayed et al ., 2003), was identified as 32 repeats of a CT dinucleotide on chromosome II in the T. brucei TREU927/4 genome reference strain. In the MITat1.2 cells used in this study, sequencing of the PCR products revealed that the loci had diverged to the extent that no contiguous CT dinucleotides longer than four repeats were present, almost certainly explaining its stability.…”

“…Microsatellite PLC (El Sayed et al ., 2003) was amplified by 27 cycles of 95°C for 50 s, 58°C for 50 s and 70°C for 50 s using the primers PLCG (5′‐CAACGACGT TGGAAGAGTGTGAAC‐3′) and PLCH3 (5′‐CCACTGACCTT TCATTTGATCGCTTTC‐3′). Microsatellite ChrII‐6 (Tait et al ., 2002; El Sayed et al ., 2003) was amplified by 30 cycles of 95°C for 50 s, 52°C for 50 s and 72°C for 2 min using the primers ChrII‐6A (5′‐GTTGTGTGAGCAACGCAAGGGCGG‐3′) and ChrII‐6B (5′‐TATAACAACAGGTGAAGGAGAGGG‐3′). Microsatellites ChrI‐D2(7) and ChrI‐15 (Hall et al ., 2003) were amplified by 28 cycles of 95°C for 50 s, 54°C for 50 s and 68°C for 50 s using the primers ChrI‐7A (5′‐CCTGTTG GCCGCATTATTCGATGC‐3′) and ChrI‐7B (5′‐TGAGGAAGT GAGGGGAGACGGAAG‐3′), and ChrI‐15 A (5′‐TGGCTAGT TACACTGTAGTTCTCC‐3′) and ChrI‐15B (5′‐CCACAAC CACTCCTTGATATTCAC‐3′) respectively.…”

Untitled

“…Mice were housed in propylene cages with sawdust bedding and were fed on Harlan, SDS formula number I (Special Diet Services Ltd.) and drinking water supplemented with 0.05% paraminobenzoic acid (PABA) to aid parasite growth [14]. Temperature was maintained between 22 and 25°C with a 12 hour light/12 hour dark cycle.…”

Molecular parasitology in the 21st Century

“…Genetic work in human trypanosomatids has been limited by their diploidy and infrequent genetic or sexual exchange that has only been described in the insect host phase of African trypanosomes [29] and Leishmania [30]. Genomic data indicate that hybrids of various lineages of T. cruzi exist indicating that genetic exchange in this parasite can occur in nature, although infrequently.…”