Generation of a single-chain Fv fragment for the monitoring of deoxycholic acid residues anchored on endogenous proteins

scFv Antibody: Principles and Clinical Application

“…Moreover, the V domains of antibody can be combined by in vitro recombination directly after the PCR of V H and V L genes into plasmid [38, 53] or phagemid [54]. Alternatively, scFv (single-chain fragment variable) can also be constructed with sequential cloning [55, 56] or combinatorial infection [57]. …”

“…Numerous scFv (single-chain fragment variable) have been constructed against hapten [55], protein [46, 58], carbohydrate [59, 60], receptor [16], tumor antigen [44, 61], and viruses [47]. All these scFv (single chain fragment variable) have good potential for use in many fields such as medical therapies and diagnostic applications.…”

“…In cases where pure antigen is not available, such as integral membrane protein, or the unknown antigen source (for novel markers on cells or tissues studies), specific antibodies must be isolated using more complex sources, such as whole cells [45, 106, 107] or tissue fragments [55]. In contrast, antibody fragments can also be raised against heterogeneous cell mixtures using fluorescence activated cells (FACs) sorting selection.…”

Novel conformation‐selective monoclonal antibodies against apoA‐I amyloid fibrils

“…In brief, total RNA, extracted from the hybridoma cells (~ 1 × 10 7 cells), was reverse‐transcribed using Superscript II reverse transcriptase (Thermo Fisher Scientific) with an oligo‐dT primer. The cDNAs obtained were used in 5'RACE with subclass‐specific forward primers: that is, mμ‐GSP1 (5′‐AGACCTGCGAGGTGGCTA), 2(5′‐GTGAAGGAAATGGTGCTG), and 3(5′‐GGATCCCGGGCTCTCGCAGGAGACGAGG) for the V H ‐cloning; mκ‐GSP1 (5′‐GTTGAAGCTCTTGACAAT), 2(5′‐ATTTTGTCGTTCACTGCC), and 3(5′‐TGGATGGTGGGAAGATG) for the V L (κ)‐cloning; or mλ‐GSP1, 2, and 3 [68] for the V L (λ)‐cloning). The V H gene of Ab#B7‐5 and the V L gene of Ab#A4‐18 were amplified using the following pairs of primers: MVH‐7 [69] and mμ‐GSP1 for Ab#B7‐5, and MKV‐6 [69] and mκ‐GSP1 for Ab#A4‐18, respectively.…”

Estudo dos efeitos da terapia de scFv que mimetiza o antígeno gp43 de Paracoccidioides brasiliensis conjugado à nanocápsulas na paracoccidioidomicose experimental

“…humanos (ZHANG et al, 2006), essa construção tem sido utilizada em diversos modelos terapêuticos contra hapteno (KOBAYASHI et al, 2005), proteínas (DAI et al, 2003GUO et al, 2003), hidratos de carbono (RAVN et al, 2004;SAKAI et al, 2007), antígenos contra tumores (SHADIDI; SIOUD, 2001) e vírus (HU et al, 2005). TURNER et al, 1997;WINTLOW, FILPPULA, 1991).…”