Funneling lignin-derived compounds into polyhydroxyalkanoate by Halomonas sp. Y3

Tang, Hao; Wang, Mingjun; Gan, Xiao-Feng; Li, Yuanqiu

doi:10.1016/j.biortech.2022.127837

Cited by 17 publications

(10 citation statements)

References 41 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Species membership was determined by amplification of the 16S rRNA gene region. Bacterial DNA was isolated using a commercial DNeasy PowerFood Microbial Kit (Qiagen, GmbH, Hilden, Germany), and amplified with 16S–F (5′–AGAGTTTGATCCTGGCTCAG–3′) and 16S–R (5′–ACGGCTACCTTGTTACGACT–3′) primers [ 55 ]. The PCR conditions for the gene amplification were as follows: 2 min of initial denaturation at 95 °C, followed by 35 amplification cycles of denaturation at 94 °C for 30 s, hybridization at 51 °C for 35 s, and extension step at 72 °C for 1 min, ending with a final extension period of 72 °C for 10 min (SimpliAmp™ Thermal Cycler, Applied Biosystems™, ThermoFisher Scientific, Waltham, MA, USA).…”

Section: Methodsmentioning

confidence: 99%

Effectiveness of a Phage Cocktail as a Potential Biocontrol Agent against Saprophytic Bacteria in Ready-To-Eat Plant-Based Food

Wójcicki

Świder

Gientka

et al. 2023

Viruses

View full text Add to dashboard Cite

This study aimed to evaluate the effectiveness of the phage cocktail to improve the microbiological quality of five different mixed-leaf salads: rucola, mixed-leaf salad with carrot, mixed-leaf salad with beetroot, washed and unwashed spinach, during storage in refrigerated conditions. Enterobacterales rods constituted a significant group of bacteria in the tested products. Selected bacteria were tested for antibiotic resistance profiles and then used to search for specific bacteriophages. Forty-three phages targeting bacteria dominant in mixed-leaf salads were isolated from sewage. Their titer was determined, and lytic activity was assessed using the Bioscreen C Pro automated growth analyzer. Two methods of phage cocktail application including spraying, and an absorption pad were effective for rucola, mixed leaf salad with carrot, and mixed leaf salad with beetroot. The maximum reduction level after 48 h of incubation reached 99.9% compared to the control sample. In washed and unwashed spinach, attempts to reduce the number of microorganisms did not bring the desired effect. The decrease in bacteria count in the lettuce mixes depended on the composition of the autochthonous saprophytic bacteria species. Both phage cocktail application methods effectively improved the microbiological quality of minimally processed products. Whole-spectral phage cocktail application may constitute an alternative food microbiological quality improvement method without affecting food properties.

show abstract

Section: Methodsmentioning

confidence: 99%

Effectiveness of a Phage Cocktail as a Potential Biocontrol Agent against Saprophytic Bacteria in Ready-To-Eat Plant-Based Food

Wójcicki

Świder

Gientka

et al. 2023

Viruses

View full text Add to dashboard Cite

show abstract

“…Y3 is a ligninolytic bacterium that can funnel lignin into PHA, exhibited poor lignin degradation performance due to low ligninolytic enzyme activity and further affected PHA production. 123 Li et al 154 introduced the laccase gene from Streptomyces coelicolor into Halomonas sp . Y3 and designed a natural strong promoter and RBS, resulting in an appropriate signal peptide and efficient Tat protein transport system to drive the efficient secretion of heterologous laccase.…”

Section: Construction Strategies For Engineered Lignin Cbp Hostsmentioning

confidence: 99%

Perspectives and advances in consolidated bioprocessing strategies for lignin valorization

Guo,

Liu,

2024

Sustainable Energy Fuels

View full text Add to dashboard Cite

show abstract

“…Biological funneling for the conversion of lignin-related aromatic compound (LRC) mixtures to performance-advantaged bioproducts (13,14) has been demonstrated, and some of the associated bioproducts include 2-pyrone-4,6-dicarboxylic acid (15)(16)(17), itaconic acid (18), polyhydroxyalkanoates (8,19,20), cis,cis-muconic acid (21)(22)(23)(24), vanillin (25,26), substituted styrene molecules (27), pyridine-2,4-dicarboxylic acids (28,29), and β-ketoadipic acid (30), among others, reviewed recently by Weiland et al (12). β-Ketoadipic acid is a six-carbon dicarboxylic acid with a β-ketone (Fig.…”

Section: Introductionmentioning

confidence: 99%

Lignin conversion to β-ketoadipic acid by Pseudomonas putida via metabolic engineering and bioprocess development

Werner,

Cordell,

Lahive

et al. 2023

Sci. Adv.

View full text Add to dashboard Cite

Bioconversion of a heterogeneous mixture of lignin-related aromatic compounds (LRCs) to a single product via microbial biocatalysts is a promising approach to valorize lignin. Here, Pseudomonas putida KT2440 was engineered to convert mixed p-coumaroyl– and coniferyl-type LRCs to β-ketoadipic acid, a precursor for performance-advantaged polymers. Expression of enzymes mediating aromatic O -demethylation, hydroxylation, and ring-opening steps was tuned, and a global regulator was deleted. β-ketoadipate titers of 44.5 and 25 grams per liter and productivities of 1.15 and 0.66 grams per liter per hour were achieved from model LRCs and corn stover-derived LRCs, respectively, the latter representing an overall yield of 0.10 grams per gram corn stover-derived lignin. Technoeconomic analysis of the bioprocess and downstream processing predicted a β-ketoadipate minimum selling price of $2.01 per kilogram, which is cost competitive with fossil carbon-derived adipic acid ($1.10 to 1.80 per kilogram). Overall, this work achieved bioproduction metrics with economic relevance for conversion of lignin-derived streams into a performance-advantaged bioproduct.

show abstract

Funneling lignin-derived compounds into polyhydroxyalkanoate by Halomonas sp. Y3

Cited by 17 publications

References 41 publications

Effectiveness of a Phage Cocktail as a Potential Biocontrol Agent against Saprophytic Bacteria in Ready-To-Eat Plant-Based Food

Effectiveness of a Phage Cocktail as a Potential Biocontrol Agent against Saprophytic Bacteria in Ready-To-Eat Plant-Based Food

Perspectives and advances in consolidated bioprocessing strategies for lignin valorization

Lignin conversion to β-ketoadipic acid by Pseudomonas putida via metabolic engineering and bioprocess development

Contact Info

Product

Resources

About