Functional Interaction of Common Allergens and a C-type Lectin Receptor, Dendritic Cell-specific ICAM3-grabbing Non-integrin (DC-SIGN), on Human Dendritic Cells

Hsu, Shih-Chang; Chen, Chien Ho; Tsai, Shih Han; Kawasaki, Hiromu; Hung, Chih‐Hsing; Chu, Yu Te; Chang, Hui-Wen; Zhou, Yufeng; Fu, Jinrong; Plunkett, Beverly; Su, Song Nan; Vieths, Stefan; Lee, Reiko T.; Lee, Yuan C.; Huang, Shau Ku

doi:10.1074/jbc.m109.058370

Cited by 87 publications

(73 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…DC-SIGN shares 77% amino acid sequence identity, similar overall structure and ligand-binding characteristics with the human receptor, DC-SIGNR (L-SIGN; CD299). Ara h 1, Der p 1, Der p 2, Can f 1 and Cyn d 1 (Bermuda grass pollen) have been reported as ligands for DC-SIGN and/or DC-SIGNR [41,42]. DC-SIGN has been suggested to modulate human DC activation for Th1 cell polarization, or IL-10-mediated regulatory responses [40,43,44].…”

Section: C-type Lectinsmentioning

confidence: 99%

What makes an allergen?

Scheurer

Toda

Vieths

2015

Clin Experimental Allergy

View full text Add to dashboard Cite

SummaryAllergic diseases are an immune disorder reacting to certain type of allergen(s). Remarkably only a small number of proteins of the plant and animal proteome act as allergens. Therefore, allergens have been clustered according to their common structural, biochemical and functional features. Evidence has accumulated that some allergens possess intrinsic adjuvant properties to stimulate the innate immunity. The adjuvant properties appear to contribute to the allergenicity of the respective proteins, namely the ability to cause allergic sensitization in susceptible subjects or allergic reactions in sensitized individuals. Here, we discuss how allergens interact with the innate immune cells, in particular dendritic cells and epithelial cells, via binding to pattern recognition receptors, exhibiting proteolytic activities and/or inducting type 2 innate lymphoid cells (ILC2), thereby contributing to the sensitization and development of allergic diseases.

show abstract

Section: C-type Lectinsmentioning

confidence: 99%

What makes an allergen?

Scheurer

Toda

Vieths

2015

Clin Experimental Allergy

View full text Add to dashboard Cite

show abstract

“…Lately, natural Der p 2 was shown to elicit the production of TNF-α through direct binding with DC-SIGN on DCs, whereas the unglycosylated recombinant form was ineffective in receptor activation [63]. Recombinant Der p 2 caused nuclear factor ĸB-dependent upregulation of pro-inflammatory cytokines in bronchial (BEAS-2B and NHBE) but not alveolar (A549) airway epithelial cells [64], whereas recombinant Der f 2 can directly stimulate IL-13 production in BEAS-2B cells [65].…”

Section: Biological Activity Of Purified Hdm Allergens and Airway Innmentioning

confidence: 99%

The Role of the House Dust Mite-Induced Innate Immunity in Development of Allergic Response

Jacquet

2010

Int Arch Allergy Immunol

View full text Add to dashboard Cite

House dust mite (HDM) represents one of the most common sources of aeroallergens worldwide and more than 50% of allergic patients are sensitized to these allergenic molecules. HDM allergy research in the past has been mainly focused on adaptive, mite allergen-dependent immune responses. In recent years it has become clear that, although the allergen-specific CD4+ Th2 cellsorchestrate HDM allergic response,the innate immune system also plays a critical role in HDM-induced allergy pathogenesis. This review will summarize insights into diverse determinants that contribute to the HDM allergenicity through the activation of innate immunity. In addition to the capacity of mite allergens to directly activate mainly skin keratinocytes and airway epithelial cells, innate pattern recognition receptor ligands derived from HDM carriers are also involved in the development of allergic response by HDM.

show abstract

“…It is difficult to avoid peanut due to many factors, including cross-contamination during food processing. What makes peanut such a potent allergen is not understood, although in human in vitro systems it was described that Ara h 1 from peanut could bind to DC-specific ICAM3-grabbing nonintegrin (DC-SIGN) in a glycosylation-dependent manner, resulting in a modified DC phenotype and increased capacity for Th2 skewing (3,4). Innate recognition of allergens has been described for other clinically relevant allergens, including dust mite allergens that activate epithelial cells and DCs through TLR4 and dectin-1 (5,6).…”

Section: Introductionmentioning

confidence: 99%

Skin exposure promotes a Th2-dependent sensitization to peanut allergens

Tordesillas¹,

Goswami²,

Benedé³

et al. 2014

J. Clin. Invest.

193

208

View full text Add to dashboard Cite

Cells were seeded in 24-well plates and stimulated with CPE or soy extract. Cells were recovered at several time points for RNA isolation with the RNeasy Mini Kit (Qiagen).Bone marrow-derived DCs. Bone marrow cells were collected from femurs and cultured for 10 days in RPMI 1640 with l-glutamine (Gibco, Life Technologies), supplemented with 10% fetal bovine serum (Gemini Bio-products), penicillin/streptomycin (Gibco, Life Technologies), 50 μM 2-Mercaptoethanol (Sigma-Aldrich), and 20 ng/ml GM-CSF (Peprotech). At day 10, bone marrow-derived DCs were collected and resuspended in complete RPMI at a concentration of 5 × 10 5 cells per ml. Cells were stimulated for 3 hours with CPE (50 μg/ml), followed by RNA isolation with the RNeasy Mini Kit (Qiagen).Real-time PCR. RT-PCR was performed, starting from 1 μg total RNA, using SuperScript II Reverse Transcriptase (Invitrogen, Life Technologies). cDNA was amplified using the Power SYBR Green PCR Master Mix (Applied Biosystems, Life Technologies) and run on an Applied Biosystems 7300 Real-Time Detection System, using the following primers: mouse Il6, F, TTCCATCCAGTTGCCTTCTTG; R, GGGAGTGGTATCCTCTGTGAAGTC; mouse Il1b (65), F, TTGACGGACCCCAAAAGAT; R, GAGCGCTCACGAACAGTTG; mouse Il10 (25), F, TGCTATGCTGCCTGCTCTTA; R, TCATTTC-CGATAAGGCTTGG; mouse Ox40l (25), F, CCCTCCAATCCAAA-GACTCA; R, ATCCTTCGACCATCGTTCAG; mouse Il33, F, ATC-GGGTACCAAGCATGAAG; R, GACTTGCAGGACAGGGAGAC; mouse Tslp (48), F, GAGAGAAATGACGGTACTCA; R, CTACAGT-TAGGTTTGCCCTA; mouse Il25, F, TGTTGCATTCTTGGCAAT-GATC; R, GACTGCAGCCCTCCTGGAT; human IL6, F, AAA-GAGGCACTGGCAGAAAA; R, CAGGGGTGGTTATTGCATCT; human IL33, F, GAGCTAAGGCCACTGAGGAA; R, TGGGCCTTT-GAAGTTCCATA.GADPH and β-actin were used as the housekeeping genes. Relative quantification was performed using the comparative threshold cycle method (2 -ΔΔCt ). The changes in gene expression were calculated with respect to the untreated cells. All amplifications were carried out in duplicates. Antigen presentation assay. Antigen presentation assay was performed as previously described (19). BALB/c mice were exposed to 10 mg OVA in the presence or absence of 1 mg CPE. After 24 hours, DCs were purified from inguinal lymph nodes by using CD11c microbeads (Miltenyi Biotec). DCs were cultured at a ratio of 1:5 with DO11.10 CD4 + T cells. After 72 hours, cells were restimulated with anti-CD3/CD28, supernatants were harvested, and cytokines were measured by ELISA according to manufacturer's instructions (all from eBioscience).In neutralization experiments, anti-ST2 was injected prior to exposure with OVA and CPE, as described above. For the OX40L neu- The Journal of Clinical InvestigationR e s e a R c h a R t i c l e 4 9 7 4

show abstract

Functional Interaction of Common Allergens and a C-type Lectin Receptor, Dendritic Cell-specific ICAM3-grabbing Non-integrin (DC-SIGN), on Human Dendritic Cells

Cited by 87 publications

References 31 publications

What makes an allergen?

What makes an allergen?

The Role of the House Dust Mite-Induced Innate Immunity in Development of Allergic Response

Skin exposure promotes a Th2-dependent sensitization to peanut allergens

Contact Info

Product

Resources

About