Full-genome sequencing of porcine circovirus 3 field strains from Denmark, Italy and Spain demonstrates a high within-Europe genetic heterogeneity

Abstract

Porcine circovirus 3 (PCV3) is a new species of the Circovirus genus, which has recently been associated with different clinical syndromes. Its presence has been reported in different countries of North and South America, Asia and recently also Europe (Poland). However, different from the other continents, no European PCV3 sequence is currently available in public databases. There is a strong need of epidemiological data and full-genome sequences from Europe because of its relevance in the understanding of PCV3 molecular epidemiology and control. To fill this lack of information, samples collected in Denmark, Italy and Spain in 2016 and 2017 were screened for PCV3. Of the Danish samples, 36 of 38 the lymph nodes, six of 20 serum samples and two of 20 lung samples tested positive. Similarly, 10 of 29 lungs, 20 of 29 organ pools, six of 33 sera and one of eight nasal swabs tested PCV3 positive in Italy. Fourteen of 94 serum pools from seven of 14 Spanish farms were also positive. Despite the convenience nature of the sampling prevents any precise prevalence estimation, the preliminary screening of the data from three European countries confirmed a rather wide PCV3 distribution in Europe. Furthermore, the analysis of the six obtained complete European PCV3 genomes and their comparison with the public available sequences seems to support a remarkable worldwide PCV3 circulation. These results underline once more the urgency of more extensive epidemiological studies to refine the current knowledge on PCV3 evolution, transmission, spreading patterns and impact on pig health.

Retrospective detection of Porcine circovirus 3 (PCV-3) in pig serum samples from Spain

“…Spanish sequences obtained in the present study and Franzo, Legnardi, Hjulsager et al. () have been coloured in red and blue, respectively. Nodes demonstrating a branch support higher than 70% have been marked with a full circle…”

“…A plasmid containing the full‐length PCV‐3 sequence (Franzo, Legnardi, Centelleghe et al., ) and double distilled water were used as positive and negative controls, respectively. To demonstrate the presence of PCV‐3 DNA in studied samples, a conventional PCR assay was performed; according to a previous protocol described (Franzo, Legnardi, Hjulsager et al., ), three μl of extracted DNA was added to a PCR mix and amplified using the same thermal protocol. The reaction was carried out in a final volume of 50 μl mixture containing 10 μl of 5× PCR Buffer, 2 μl of 10 μM dNTPs, 1 μl of 10 pmol forward primer (located in genomic positions 233‐255), 5′‐AAAGCCCGAAACACAGGTGGTGT‐3′, 1 μl of 10 pmol of a reverse primer 5′‐TTTTCCCGCATCCTGGAGGACCAAT‐ 3′ (placed between nucleotide positions 718–742), 1 Units of DNA polymerase Platinum™ SuperFi™ (Invitrogen™) and 32.5 μl of water.…”

“…PCV‐3 has a circular genome that contains 1,999–2,000 nucleotides with two major open reading frames (ORFs) oriented in opposite directions encoding capsid (Cap) and replicase (Rep) proteins (Palinski et al., ). A number of complete genomes of PCV‐3 are available so far, indicating a fairly high nucleotide identity ranging from 96% to 100% (Franzo, Legnardi, Hjulsager et al., ; Zheng et al., ). Based on phylogenetic analyses, PCV‐3 has a close evolutionary relationship with Fox circovirus , Canine circovirus and Bat circoviruses (Palinski et al., ; Phan et al., ).…”

First detection of porcine circovirus type 3 in Colombia and the complete genome sequence demonstrates the circulation of PCV3a1 and PCV3a2

“…), Spain, Denmark, Italy (Franzo et al . ,b), Sweden (Ye et al . ), the United Kingdom (Collins et al .…”

Diagnostic accuracy of two DNA‐based molecular assays for detection of porcine circovirus 3 in swine population using Bayesian latent class analysis

“…; Franzo et al . ), suggesting its ubiquity and prolonged circulation over time (Klaumann et al . ).…”