Filamentous bacteriophages are associated with chronic Pseudomonas lung infections and antibiotic resistance in cystic fibrosis

Abstract

Filamentous bacteriophage (Pf phage) contribute to the virulence of Pseudomonas aeruginosa infections in animal models, but their relevance to human disease is unclear. We sought to interrogate the prevalence and clinical relevance of Pf phage in patients with cystic fibrosis (CF) using sputum samples from two well-characterized patient cohorts. Bacterial genomic analysis in a Danish longitudinal cohort of 34 patients with CF revealed that 26.5% (n = 9) were consistently Pf phage positive. In the second cohort, a prospective cross-sectional cohort of 58 patients with CF at Stanford, sputum qPCR analysis showed that 36.2% (n = 21) of patients were Pf phage positive. In both cohorts, patients positive for Pf phage were older, and in the Stanford CF cohort, patients positive for Pf phage were more likely to have chronic P. aeruginosa infection and had greater declines in pulmonary function during exacerbations than patients negative for Pf phage presence in the sputum. Last, P. aeruginosa strains carrying Pf phage exhibited increased resistance to antipseudomonal antibiotics. Mechanistically, in vitro analysis showed that Pf phage sequesters these same antibiotics, suggesting that this mechanism may thereby contribute to the selection of antibiotic resistance over time. These data provide evidence that Pf phage may contribute to clinical outcomes in P. aeruginosa infection in CF.

Methods for Extraction and Detection of Bacteriophage DNA from the Sputum of Patients with Cystic Fibrosis

“…The second method includes a combination of mechanical homogenization with bead beating and heat followed by use of a commercially available DNA extraction kit designed for isolation of genomic DNA. [20] We refer to this method as mechanical dissociation. After processing Pf phage were measured in all aliquots using qPCR ( Figure 2) with significantly more Pf phage detected in the sample processed by mechanical dissociation.…”

“…Pf phage and P. aeruginosa in sputum was quantified by quantitative PCR as we have previously described. [15,20] targeting Pfcon (PA0717), a gene that is conserved across diverse strains of Pf phage (Pf1, Pf4, Pf5), were used together with a PA0717 probe (AACGCTGGGTCGAAG). For P. aeruginosa quantification, primers targeting the 50S ribosomal protein gene rpIU (rpIU-F (CAAGGTCCGCATCATCAAGTT) and rpIU-R (GGCCCTGACGCTTCATGT)) were used together with a rpIU probe (CGCCGTCGTAAGC).…”

“…We and others have recently reported that Pf phage influence the pathogenesis of P. aeruginosa infections in the lung and other environments by inducing liquid crystal biofilm and promoting chronic infection. [11,12,[15][16][17][20][21][22] For all of these reasons there is a pressing need for effective and reliable protocols for assessments of both phage and bacteria in CF sputum. [23,24] Respiratory secretions are primarily composed of polymeric mucins (MUC5AC and MUC5B) that form a gel like material with complex rheological properties that form the basis for its function as an innate defense barrier, including viscoelasticity, cohesiveness, adhesiveness and wetness.…”

“…To this end, our protocols have been optimized for collecting DNA from Pf bacteriophage and the bacterium which produces it, P. aeruginosa. [20] We have focused on a DNA phage here, though it would be straightforward to modify this protocol to examine RNA viruses. These protocols reflect our recent experience in quantification and sequencing of these microbes.…”

“…These protocols reflect our recent experience in quantification and sequencing of these microbes. [15][16][17]20] To our knowledge this is the first systematic approach to develop a standardized method that could be used by other investigators and thus allow for meaningful comparisons. Our hope is that sharing our optimized protocols will facilitate future studies on both bacteria and phage in CF airway infections.…”