Far upstream element-binding protein 1 and RNA secondary structure both mediate second-step splicing repression

Abstract

Splicing of mRNA precursors consists of two steps that are almost invariably tightly coupled to facilitate efficient generation of spliced mRNA. However, we described previously a splicing substrate that is completely blocked after the first step. We have now investigated the basis for this unusual second-step inhibition and unexpectedly elucidated two independent mechanisms. One involves a stem-loop structure located downstream of the 3′splice site, and the other involves an exonic splicing silencer (ESS) situated 3′ to the structure. Both elements contribute to the secondstep block in vitro and also cause exon skipping in vivo. Importantly, we identified far upstream element-binding protein 1 (FUBP1), a single-stranded DNA-and RNA-binding protein not previously implicated in splicing, as a strong ESS binding protein, and several assays implicate it in ESS function. We demonstrate using depletion/add-back experiments that FUBP1 acts as a second-step repressor in vitro and show by siRNA-mediated knockdown and overexpression assays that it modulates exon inclusion in vivo. Together, our results provide additional insights into splicing control, and identify FUBP1 as a splicing regulator. R emoval of introns from pre-mRNAs by splicing is a precise process required for the expression of nearly all genes in human cells. Splicing takes place via two sequential transesterification reactions in the spliceosome, a large complex consisting of several hundred proteins and five small nuclear RNAs (1, 2). During the first step, an adenosine residue designated the branch point, attacks the 5′ splice site (5′SS) to generate the splicing intermediates (free exon1 and lariat-exon2). In the second step, the first exon attacks the 3′ splice site (3′SS), yielding ligated exons and a lariat intron.Splicing, like numerous other cellular processes, must be under strict regulatory control. Indeed, aberrant splicing is involved in a wide range of human diseases (3, 4). Besides the core splicing signals, additional cis-regulatory elements play important roles in splicing and its control. These elements exist within exons and introns and can function both positively and negatively (5-7). Two major classes of exonic elements have been identified, known as exonic splicing enhancers (ESEs) and exonic splicing silencers (ESSs), and both of these contribute to regulation of alternative splicing (AS). ESEs are usually bound by members of the serine/arginine-rich (SR) protein family to enhance recognition of adjacent splice sites. By contrast, ESSs function to inhibit the use of adjacent splice sites, and are generally dependent on the interaction with members of the heterogeneous nuclear ribonucleoprotein(hnRNP) family, as well as other splicing regulators such as NOVA1/2 and RBFOX1/2 (8, 9).A good deal is now known about the structure and function of ESSs. For example, several large-scale strategies have been developed to identify and characterize ESSs (10-12). The sequences of known and selected ESSs share little similarity with each other, ...

The Splicing Factor FUBP1 Is Required for the Efficient Splicing of Oncogene MDM2 Pre-mRNA

“…However, despite the fact that FUBP1 has been isolated in association with spliceosomal complexes (40) and includes four K homology domains (domains homologous to heterogeneous nuclear ribonucleoprotein K, a component of the spliceosomal H complexes (52)), its role in splicing regulation has remained speculative until recently. Li et al (41) showed that FUBP1 suppresses triadin exon 10 splicing in the context of a chimeric reporter minigene through its binding of a 30-nt AU-rich exonic splicing silencer element in this exon at a consensus sequence AUAUAUGAU. Our study, in contrast, shows that FUBP1 functions as an enhancer of splicing in the context of the oncogene MDM2.…”

“…48 h post-transfection, cells were treated with cisplatinum for 24 h at and harvested (total of 72 h siRNA treatment) in a procedure similar to the overexpression assays. The siRNA sequences used were nonspecific (AAGGUCCGGCUCCCCCAAAUG) (44) and siFUBP1 (GGAGGAGUUAACGACGCUUUU) (41).…”

“…Although a close family member FUBP2 (KHSRP) is a known splicing regulator (39), FUBP1 itself had previously not been implicated in splicing despite the fact that its presence had been identified in the spliceosomal complex (40). It was only recently that evidence describing a splicing regulatory role for FUBP1 emerged in which FUBP1 has been demonstrated to function as a suppressor of the second step of splicing through its binding of a 30-nt 2 AU-rich exonic splicing silencer element on the triadin exon 10 in a chimeric minigene context (41). In contrast, in this study, we describe FUBP1 as a positive splicing regulator of the oncogene MDM2.…”

BCLAF1 and its splicing regulator SRSF10 regulate the tumorigenic potential of colon cancer cells

“…RNA extraction and reverse transcription were all carried out as described previously 39 . Briefly, total RNAs were extracted from indicated cell lines and reverse transcription was performed using oligo (dT) priming and M-MLV Reverse Transcriptase according to the manufacturer's instructions (Promega Corporation, Madison, WI).…”

“…Western blotting and gel-shift assays were carried out as previously described 20,39 . Briefly, for western blotting, equal amounts of whole cellular extracts were subjected to 10% SDS-PAGE gels and detected using indicated antibodies.…”