Expression of the Cytochrome P450 Gene <i>CYP6A1</i> in the Housefly, <i>Musca domestica</i>

Cariño, Flerida A.; Koener, J. F.; Plapp, Frederick W.

doi:10.1021/bk-1992-0505.ch003

Cited by 54 publications

(51 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…For insects, induction of a P450-dependent enzyme activity (Agosin et al, 1969) and of a specifi c P450 gene (Cariño et al, 1992) by phenobarbital were reported long ago. Molecular studies in several insect species have now identifi ed many phenobarbital-inducible genes (review in Feyereisen, 2005).…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Xenobiotic response in Drosophila melanogaster: Sex dependence of P450 and GST gene induction

Goff

Hilliou

Siegfried

et al. 2006

Insect Biochemistry and Molecular Biology

146

109

View full text Add to dashboard Cite

Section: Discussionmentioning

confidence: 99%

“…Induction of specifi c genes is now well documented (e.g., CYP6A1; Cariño et al, 1992) and induction of P450 genes by a wide variety of chemicals is now amply demonstrated (review in Feyereisen, 2005), although the pattern of response within the whole multigene families or the selectivity of the inducer has yet to be documented.…”

Section: Introductionmentioning

confidence: 99%

Xenobiotic response in Drosophila melanogaster: Sex dependence of P450 and GST gene induction

Goff

Hilliou

Siegfried

et al. 2006

Insect Biochemistry and Molecular Biology

146

109

View full text Add to dashboard Cite

“…Midgut poly(A)+ RNA was isolated as described (19). PCR on midgut cDNA was performed as described above, using an annealing temperature.of 55oC with the following primers: GGTCTCGGCAAGAGAAGCAAAATGT and GACGCT-GTGCTCCAGATGGTGCTC.…”

Section: Methodsmentioning

confidence: 99%

Expression of the allatostatin gene in endocrine cells of the cockroach midgut.

Reichwald

Unnithan

Davis

et al. 1994

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

Cockroach allatostatins are neuropeptides that have been isolated from the brain of Diploptera punctata and shown to inhibit juvenile hormone production by the corpora allata. Enzyme-linked immunoassay and Immunocytochemistry with antisera to two allatostatins, ASB2 (AYSYV-SEYKRLPVYNFGL-NH2) and ASAL (APSGAQRLYGFGL-NH2), revealed that allatostatins were located not only in the insect brain but also in several peripheral tissues Including the cockroach midgut and hindgut. Allatostatin-like immunoreactivity was found in nerve fibers of the stomatogastric nervous system as well as in intrinsic endocrine cells of the midgut.Midgut extracts were shown to be biologically active in an allatostatin bioassay and to contain several alatostatin-like peptides, including the octadecapeptide ASB2, which was identified by mass spectrometry following HPLC purification.Reverse transcription of brain mRNA followed by PCR with degenerate oligonucleotides for ASB2 and ASAL yielded a 338-bp fragment of the allatostatin gene that encoded six allatostatins. In situ hybridization with this probe confirmed that an allatostatin gene is expressed in intrinsic endocrine cells of the midgut. Reverse transcription of midgut mRNA followed by PCR and sequencing of the product revealed that the same gene is expressed in the midgut and in the brain. Allatostatins are thus an example of insect "brain-gut peptides" and we suggest that their function may not be restricted to the regulation of juvenile hormone production.

show abstract

“…In fact, several P450s can be overproduced together in an individual, e.g. CYP6A2 and CYP4E2 in the RDDT R strain of Drosophila (Amichot et al 1994), and CYP6A1 and CYP6D1 in LearnPyrR house £ies (Carino et al 1992). This overproduction can be due to an overexpression of the gene encoding these proteins, but a stabilization of the corresponding mRNA or protein cannot be excluded; to date, no gene ampli¢cation has been demonstrated in strains overproducing P450.…”

Section: P450 Monooxygenase Activities and Content Of P450 In Resistamentioning

confidence: 99%

Cytochrome P450 monooxygenases and insecticide resistance in insects

Bergé¹,

Feyereisen

Amichot³

1998

Phil. Trans. R. Soc. Lond. B

Self Cite

200

124

View full text Add to dashboard Cite

Cytochrome P450 monooxygenases are involved in many cases of resistance of insects to insecticides. Resistance has long been associated with an increase in monooxygenase activities and with an increase in cytochrome P450 content. However, this increase does not always account for all of the resistance. In Drosophila melanogaster, we have shown that the overproduction of cytochrome P450 can be lost by the £y without a corresponding complete loss of resistance. These results prompted the sequencing of a cytochrome P450 candidate for resistance in resistant and susceptible £ies. Several mutations leading to amino-acid substitutions have been detected in the P450 gene CYP6A2 of a resistant strain. The location of these mutations in a model of the 3D structure of the CYP6A2 protein suggested that some of them may be important for enzyme activity of this molecule. This has been veri¢ed by heterologous expression of wild-type and mutated cDNA in Escherichia coli. When other resistance mechanisms are considered, relatively few genetic mutations are involved in insecticide resistance, and this has led to an optimistic view of the management of resistance. Our observations compel us to survey in more detail the genetic diversity of cytochrome P450 genes and alleles involved in resistance.

show abstract

Expression of the Cytochrome P450 Gene CYP6A1 in the Housefly, Musca domestica

Cited by 54 publications

References 0 publications

Xenobiotic response in Drosophila melanogaster: Sex dependence of P450 and GST gene induction

Xenobiotic response in Drosophila melanogaster: Sex dependence of P450 and GST gene induction

Expression of the allatostatin gene in endocrine cells of the cockroach midgut.

Cytochrome P450 monooxygenases and insecticide resistance in insects

Contact Info

Product

Resources

About