Expression and role of PGP, BCRP, MRP1 and MRP3 in multidrug resistance of canine mammary cancer cells

Abstract

BackgroundIn both women and female dogs, the most prevalent type of malignant neoplasm is the spontaneous mammary tumor. In dogs, half of these are malignant. The treatment of choice for the canine patients is surgical mastectomy. Unfortunately, it often fails in high-risk, locally invasive mammary tumors as of during the time of the surgery the micro-metastases are present. Moreover, there are neither large studies conducting to prove of the benefit from the chemotherapy in dogs nor established chemotherapy treatment protocols available. Additionally, the effectiveness of each individual chemotherapeutic agent and drug resistance of canine mammary cancer have not yet been characterized. That has become the aim of our study, to assess the expression of PGP, BCRP, MRP1 and MRP3 in canine mammary cancer cell lines and to investigate their role in cancer resistance to vinblastine, cisplatin and cyclophosphamide with using RNAi approach.ResultsThe results suggested that in canine mammary cancer, the vinblastine efflux was mediated by PGP and MRP1 proteins, cisplatin efflux was mediated by all four examined efflux pumps (PGP, BCRP, MRP1 and MRP3), whereas cyclophosphamide resistance was related to BCRP activity. RNAi silencing of these efflux pumps significantly decreased IC50 doses of the examined drugs in canine mammary carcinoma cells.ConclusionsOur results have indicated the treatment of cells involving use of the siRNA targeting efflux pumps could be a beneficial approach in the future.

Canine mammary carcinoma cell line are resistant to chemosensitizers: verapamil and cyclosporin A

“…To assess the role of P-gp inhibitors in vitro in canine mammary cancer we used cell lines showing high expression of P-gp (Pawłowski et al 2013). Real-time rt-PCR analysis revealed that relative mdr1 expression in the CMT-W1 cell line was 17.85 and in CMT-W2 16.42 (Pawłowski et al 2013), whereas in CMT-W1M and CMT-W2M it was 17.05 and 18.04, respectively.…”

“…As a control for this experiment, we used P114 cell line, which is sensitive to vinblastine treatment, probably due to lower P-gp expression than the examined cell lines (Król et al 2010a, Pawłowski et al 2013.…”

“…Primers used to detect the expression of multidrug resistance 1 (mdr1) gene were designed using PRIMER3 software (free on-line access) and checked using Oligo Calculator (free on-line access) and Primer-Blast (NCBI database). The sequences used were: GCTTAACACCCGGCTCACAGAC and TAAGAAAGCGGCACCAATAGAAAT (optimal annealing temperature: 72 o C, optimal annealing time: 10 sec) (Pawłowski et al 2013). Ribosomal Protein 19 (rps19) and hypoxanthine phosphoribosyltransferase (hprt genes were used as non-regulated references for the normalization of target gene expression (Brinkhof et al 2006, Etschmann et al 2006.…”

“…P-gp, the product of the mdr-1 gene is expressed in the mammalian intestine, liver and other tissues. In cancer cell lines, P-gp is responsible for the drug-resistant phenotype (Lee et al 1996, Pawłowski et al 2013) which can lead to failure in therapy. For this reason currently one of the goals of experimental and clinical oncology is to reverse cancer MDR.…”

Establishment of 5-Fluorouracil-resistant canine mammary tumor cell line

“…These proteins can protect the cells from the chemotherapy by pumping the drugs out of cells after consuming ATP (Sosnik 2013). Many studies have shown that drug resistance in dogs was also due to the expression of ABC proteins, such as P-glycoprotein (PGP), breast cancer resistance protein (BCRP), multidrug resistance-associated protein 1 (MRP1) and multidrug resistance--associated protein 3 (MRP3) (Nakaichi et al 2007, Honscha et al 2009, Pawlowski et al 2013, Tomiyasu et al 2014.…”