Evolutionary characterization of the West Nile Virus complete genome

Gray, Rebecca; Véras, Nazle Mendonça Collaço; Santos, Luciane Amorim; Salemi, Marco

doi:10.1016/j.ympev.2010.01.019

Cited by 24 publications

(26 citation statements)

References 35 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…1C and Fig. S1) is congruent with that obtained previously using subgenomic sequences (26,30) while providing additional resolution and dates of lineage movement. In addition to discriminating the previously defined NY99 and WN02 lineages (30), our data reveal structure in sequences sampled from western areas: the majority of Californian sequences cluster together with basal lineages from Texas [defined as clade "D" in Gray et al (26)].…”

Section: Resultssupporting

confidence: 89%

“…the epidemic's spatial dynamics have been explored only theoretically (22) or at very local scales (23,24), and values reported for the basic reproductive number, R 0 , of the epidemic vary widely (14,21,25). Most phylogenetic studies have revealed little about the epidemic's spatial structure due to the limited diversity of the subgenomic sequences typically used (26).…”

mentioning

confidence: 99%

See 1 more Smart Citation

Unifying the spatial epidemiology and molecular evolution of emerging epidemics

Pybus

Suchard

Lemey

et al. 2012

Proc. Natl. Acad. Sci. U.S.A.

258

350

View full text Add to dashboard Cite

We introduce a conceptual bridge between the previously unlinked fields of phylogenetics and mathematical spatial ecology, which enables the spatial parameters of an emerging epidemic to be directly estimated from sampled pathogen genome sequences. By using phylogenetic history to correct for spatial autocorrelation, we illustrate how a fundamental spatial variable, the diffusion coefficient, can be estimated using robust nonparametric statistics, and how heterogeneity in dispersal can be readily quantified. We apply this framework to the spread of the West Nile virus across North America, an important recent instance of spatial invasion by an emerging infectious disease. We demonstrate that the dispersal of West Nile virus is greater and far more variable than previously measured, such that its dissemination was critically determined by rare, long-range movements that are unlikely to be discerned during field observations. Our results indicate that, by ignoring this heterogeneity, previous models of the epidemic have substantially overestimated its basic reproductive number. More generally, our approach demonstrates that easily obtainable genetic data can be used to measure the spatial dynamics of natural populations that are otherwise difficult or costly to quantify.phylogeny | phylogeography | transmission T he explanation of spatial patterns of infectious disease, particularly those of emerging pathogens, has remained a central problem of epidemiology since its inception (1). The existence and nature of traveling waves of infection were first explained in theoretical models (2, 3) and later quantified in empirical studies of rabies and the Black Death (4, 5). These and other studies highlighted the fundamental problem of spatial autocorrelation: observations of infection are statistically dependent due to transmission among proximate individuals, greatly complicating the analysis of spatiotemporal incidence. Consequently, many recent analyses of spatial epidemic behavior use detailed mathematical models of spatial structure to account for autocorrelation (6). Entirely independently, in the field of evolutionary biology there has developed a separate body of work, now termed phylogeography, which focuses on reconstructing past movement events from the genome sequences of sampled organisms (7-10). However, these evolutionary tools typically generate descriptive results that, though informative, remain divorced from epidemiological theory. Crucially neither approach can be considered complete when applied to rapidly evolving viruses, whose spatial, epidemic, and evolutionary dynamics occur on the same timescale (11), necessitating the development of methods that consider all these processes together.Here we introduce a unique approach that integrates the disciplines of spatial epidemiology and phylogenetics. To illustrate the utility of this approach, we show how, from pathogen genomes alone, it can estimate the diffusion coefficient (D) of an epidemic as well as variation in the process of spatial spread. D is...

show abstract

Section: Resultssupporting

confidence: 89%

mentioning

confidence: 99%

Unifying the spatial epidemiology and molecular evolution of emerging epidemics

Pybus

Suchard

Lemey

et al. 2012

Proc. Natl. Acad. Sci. U.S.A.

258

350

View full text Add to dashboard Cite

show abstract

“…We used the GTR+Γ+I (general time reversible with gamma rate distribution and invariable sites) model to infer nucleotide substitution frequencies, an uncorrelated lognormal clock model to infer the mutation rate, and a Bayesian Skyline tree prior to model changes in population size. The evolution rate mean was restricted to 10 −4 through 9 × 10 −4 substitutions/site/year, consistent with previously reported rates for WNV evolution ( 7 , 33 ). …”

Section: Methodssupporting

confidence: 87%

Terrestrial Bird Migration and West Nile Virus Circulation, United States

Swetnam¹,

Widen²,

Wood³

et al. 2018

Emerg. Infect. Dis.

View full text Add to dashboard Cite

Host migration and emerging pathogens are strongly associated, especially with regard to zoonotic diseases. West Nile virus (WNV), a mosquitoborne pathogen capable of causing severe, sometimes fatal, neuroinvasive disease in humans, is maintained in highly mobile avian hosts. Using phylogeographic approaches, we investigated the relationship between WNV circulation in the United States and the flight paths of terrestrial birds. We demonstrated southward migration of WNV in the eastern flyway and northward migration in the central flyway, which is consistent with the looped flight paths of many terrestrial birds. We also identified 3 optimal locations for targeted WNV surveillance campaigns in the United States—Illinois, New York, and Texas. These results illustrate the value of multidisciplinary approaches to surveillance of infectious diseases, especially zoonotic diseases.

show abstract

“…The NS3 gene of WNV was selected for analysis because this gene was previously shown to have a strong phylogenetic signal. 12 The RNA was extracted from primary viral isolates using the Viral RNA Kit (Qiagen). The RT-PCR was performed using the Titan OneTube RT-PCR System (Roche Diagnostics, Indianapolis, IN) and primers WNV4532f (TCGCGATTAGTGCGTACACC) and WNV6516r (GAAGTGCTCAGGCATCTTTCC).…”

Section: Mosquito Collections and Identification Trapping Of Mosquitmentioning

confidence: 99%

Arboviruses in North Dakota, 2003–2006

Anderson¹,

Main²,

Armstrong³

et al. 2015

The American Society of Tropical Medicine and Hygiene

View full text Add to dashboard Cite

Abstract. To investigate arbovirus transmission in North Dakota, we collected and screened mosquitoes for viral infection by Vero cell culture assay. Seven viruses were isolated from 13 mosquito species. Spatial and temporal distributions of the important vectors of West Nile virus (WNV), Cache Valley virus, Jamestown Canyon virus (JCV), and trivittatus virus are reported. Snowshoe hare virus, Potosi virus, and western equine encephalomyelitis virus were also isolated. The risks of Culex tarsalis and Aedes vexans transmitting WNV to humans were 61.4% and 34.0% in 2003-2006, respectively, but in 2003 when the largest epidemic was reported, risks for Ae. vexans and Cx. tarsalis in Cass County were 73.6% and 23.9%, respectively. Risk of humans acquiring an infectious bite was greatest from about the second week of July through most of August. West Nile virus sequences were of the WN02 genotype. Most JCV strains belonged to a single clade of genetically related strains. Cache Valley virus and JCV were prevalent during August and early September and during July and August, respectively.

show abstract

Evolutionary characterization of the West Nile Virus complete genome

Cited by 24 publications

References 35 publications

Unifying the spatial epidemiology and molecular evolution of emerging epidemics

Unifying the spatial epidemiology and molecular evolution of emerging epidemics

Terrestrial Bird Migration and West Nile Virus Circulation, United States

Arboviruses in North Dakota, 2003–2006

Contact Info

Product

Resources

About