Evaluation of HPFH and δβ-thalassemia mutations in a Brazilian group with high Hb F levels

Abstract

ABSTRACT. Fetal hemoglobin (Hb F) is characteristic of the fetal development period. However, in some genetic conditions, such as hereditary persistence of fetal hemoglobin (HPFH) and deltabeta thalassemia (δβ-thalassemia), Hb F continues to be produced in adulthood. We evaluated the frequency of two mutations of HPFH, HPFH-1 and HPFH-2 African, and two mutations in δβ-thalassemia, Sicilian and Spanish, in a Brazilian population. Peripheral blood samples were collected from adults from hospitals and blood centers in southeast and northeast Brazil. These individuals were healthy and without complaints of anemia, but had increased Hb F. Samples were submitted to electrophoretic and chromatographic analyses to quantify Hb F values and, subsequently, to molecular analyses to verify the mutations. In the molecular analysis, 16 of the 60 samples showed a heterozygous profile for the HPFH mutations, two for HPFH-1 and 14 for HPFH-2. In the same sample set, three were heterozygous for Spanish δβ-thalassemia and none were heterozygous for Sicilian δβ-thalassemia. The Hb F values in the HPFH-2 heterozygotes differed from those previously reported for this mutation. In this group, the HPFH mutations were more frequent than the δβ-thalassemia mutations. The finding of these mutations in this Brazilian population reflects the mixing process that occurred during its formation.

Contrasting co-inheritance of alpha and beta mutations in delta beta thalassemia and hereditary persistence of fetal hemoglobin: a study from India

“…In HPFH-3, the deletion removes 48.5 kb of a DNA segment, starting from the 5 ′ end of the ψβ gene to a region 30 kb downstream of the β-globin gene in an L1 repetitive region. This rare genetic trait is known to result from more than 40 deletions worldwide and is characterized by normal red cell indices and is asymptomatic except for raised HbF [18,19]. In our study, among the 52 patients with raised HbF, all the 28 HPFH patients showed HPFH-3 deletion, and these patients were heterozygous.…”

Haematological Characterisation and Molecular Basis of Asian Indian Inversion Deletions Delta Beta Thalassemia: A Case Report

“…HPFH is associated either with the occurrence of single-point mutations in the promoter region of two γ chains or β-globin gene cluster deletions. It is usually characterised in heterozygotes by higher levels of HbF (upto 30%) with normal red cell indices [3]. Individuals with these disorders exhibit milder clinical symptoms than those with typical β-thalassemia, due to the beneficial effect of HbF on red blood cell production and survival…”

Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients

“…On the other hand, δβ‐thal Spanish is less common in Latin American countries as only few reports have been published in Venezuela (0.7%) and Brazil (present in 3/60 individuals with increased HbF); however, in Spain, this variant is rather frequent as 7% of thalassemia carriers have δβ‐thal Spanish type; therefore, we assume that this allele was introduced to Mexican population through the Spaniards during the colonization.…”