Estrogen modulates iodoacetate‐induced gene expression in bovine cartilage explants

Sniekers, Y.H.; Osch, Gerjo J.V.M. van; Jahr, Holger; Weinans, Harrie; Leeuwen, Johannes P.T.M. van

doi:10.1002/jor.21042

Cited by 10 publications

(9 citation statements)

References 42 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…qPCR was performed in 20 mL reactions on an ABPrism 7000 system (Applied Biosystems) using either TaqMan Universal PCR mastermix (Applied Biosystems) or SybrGreen (Eurogentec). Expression of collagen type 2 (Fw: CCGGTATGTTTCGTG CAGCCATCCT; Rv: GGCAATAGCAGGTTCACGTACA), 18 collagen type 1 (Fw: CAGCCGCTTCACCTACAGC; Rv: TTTTGTATTCAATCACTGTCTTGCC; probe: Fam-CGGTG TGACTCGTGCAGCCATC-Tamra), aggrecan (Fw: AATTAC CAGCTACCCTTCACCTGTA; Rv: TCCGAAGATTCTGGC ATGCT), 18 collagen type X (Fw: ACTTCTCTTACCACAT ACACG; Rv: CCAGGTAGCCCTTGATGTACT), matrix metalloproteinase 13 (MMP13, Fw: TCTTGTTGCTGCCCATG AGT; Rv: GGCTTTTGCCAGTGTAGGTGTA), 18 and of the aggrecanases a disintegrin and metalloproteinase with thrombospondin motifs 4 (ADAMTS4) (Fw: GAAGCAAT GCACTGGTC TGA; Rv: CCGAAGCCATTGTCTAGGAA) and ADAMTS5 (Fw: GCAGTATGACAAATGTGGCG; Rv: TTTATGTGAGT CGCCCCTTC) was assessed. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH, Fw: GTCAACGGATTT GGTCG TATTGGG; Rv: TGCCATGGGTGGAATCATATTGG; probe: Fam-TGGCGCCCCAACCAGCC-Tamra) 19 and b-Actin (Fw: TTACAACGAGCTGCGTGTGG; Rv: TGGCAGGAGTG TT GAACGTC) were tested as reference genes.…”

Section: Rna Isolation and Qpcrmentioning

confidence: 99%

An Osteochondral Culture Model to Study Mechanisms Involved in Articular Cartilage Repair

Melle

Mandl

Kops

et al. 2012

Tissue Engineering Part C: Methods

Self Cite

View full text Add to dashboard Cite

Although several treatments for cartilage repair have been developed and used in clinical practice the last 20 years, little is known about the mechanisms that are involved in the formation of repair tissue after these treatments. Often, these treatments result in the formation of fibrocartilaginous tissue rather than normal articular cartilage. Because the repair tissue is inferior to articular cartilage in terms of mechanical properties and zonal organization of the extracellular matrix, complaints of the patient may return. The biological and functional outcome of these treatments should thus be improved. For this purpose, an in vitro model allowing investigation of the involved repair mechanisms can be of great value. We present the development of such a model. We used bovine osteochondral biopsies and created a system in which cartilage defects of different depths can be studied. First, our biopsy model was characterized extensively: we studied the viability by means of lactate dehydrogenase (LDH) excretion over time and we investigated expression of cartilage-related genes in osteochondral biopsies and compared it with conventional cartilage-only explants. After 28 days of culture, LDH was detected at low levels and mRNA could be retrieved. The expression of cartilage-related genes decreased over time. This was more evident in cartilage-only explants, indicating that the biopsy model provided a more stable environment. We also characterized the subchondral bone: osteoclasts and osteoblasts were active after 28 days of culture, which was indicated by tartrate acid phosphatase staining and alkaline phosphatase measurements, respectively, and matrix deposition during culture was visualized using calcein labeling. Second, the applicability of the model was further studied by testing two distinct settings: (1) implantation of chondrocytes in defects of different depths; (2) two different seeding strategies of chondrocytes. Differences were observed in terms of volume and integration of newly formed tissue in both settings, suggesting that our model can be used to model distinct conditions or even to mimic clinical treatments. After extensive characterization and testing of our model, we present a representative and reproducible in vitro model that can be used to evaluate new cartilage repair treatments and study mechanisms in a controlled and standardized environment.

show abstract

Section: Rna Isolation and Qpcrmentioning

confidence: 99%

An Osteochondral Culture Model to Study Mechanisms Involved in Articular Cartilage Repair

Melle

Mandl

Kops

et al. 2012

Tissue Engineering Part C: Methods

Self Cite

View full text Add to dashboard Cite

show abstract

“…Estrogens are critical modulators of bone homeostasis, in females and in males (6). They have also been shown to modulate chondrocyte activity and the synthesis of a variety of factors, including metalloproteinases, nitric oxide and reactive oxygen species, involved in the anabolism and catabolism of the cartilage matrix (7)(8)(9)(10). Estrogens act through the binding to two types of specific estrogen receptors (ER), encoded by different genes:  (or ESR1) and  (or ESR2).…”

Section: Introductionmentioning

confidence: 99%

Common variations in estrogen-related genes are associated with severe large-joint osteoarthritis: a multicenter genetic and functional study

Riancho

García-Ibarbia

Gravani

et al. 2010

Osteoarthritis and Cartilage

View full text Add to dashboard Cite

show abstract

“…Accumulating evidence supports a role of estrogen in adult joint tissues but, similar to ERR␣, estrogen may have dual effects (46,47). For example, reports of the efficacy of estrogen replacement therapy in restoring cartilage in joint tissues in patients with OA are mixed (48,49), possibly reflecting both the proinflammatory and antiinflammatory effects attributed to estrogen (47,50). Furthermore, circulating IL-1␤ levels have been shown to be increased after menopause, and estrogen modulates IL-1␤-induced proteoglycan degradation and de novo expression of MMPs 1, 3, and 13 in chondrocytes (47), activities that parallel ERR␣ regulation of MMP-13.…”

mentioning

confidence: 99%

Estrogen receptor–related receptor α regulation by interleukin‐1β in prostaglandin E₂– and cAMP‐dependent pathways in osteoarthritic chondrocytes

Bonnelye¹,

Reboul²,

Duval³

et al. 2011

Arthritis & Rheumatism

View full text Add to dashboard Cite

Objective. We reported previously that the orphan nuclear receptor, estrogen receptor-related receptor ␣ (ERR␣), is expressed in articular chondrocytes and is dysregulated in a mouse model of inflammatory arthritis. The aim of this study, therefore, was to determine whether ERR␣ is also dysregulated in patients with osteoarthritis (OA).Methods. ERR␣ messenger RNA (mRNA) and protein were quantified in normal and OA cartilage samples and in OA chondrocytes in vitro, with and without short-term treatment with a variety of OAassociated factors and signaling pathway agonists and inhibitors.Results. ERR␣ expression was lower in OA than in normal articular cartilage. Interleukin-1␤ (IL-1␤) markedly up-regulated ERR␣ expression in OA chondrocytes in vitro, and agonist or inhibitor treatment indicated that the up-regulation was dependent on cyclooxygenase 2 (COX-2; NS398), prostaglandin E 2 , cAMP (8-bromo-cAMP), and protein kinase A (PKA; KT5720). Treatment with the ERR␣ inverse agonist XCT790 decreased the expression of SOX9 and the up-regulation of ERR␣ by IL-1␤, suggesting autoregulation of ERR␣ in the IL-1␤ pathway. Matrix metalloproteinase 13 (MMP-13) expression was also decreased by treatment with XCT790 plus IL-1␤ versus IL-1␤ alone, and the down-regulation of MMP-13 mRNA and protein observed with XCT790 alone suggests that the up-regulation of MMP-13 by IL-1␤ is ERR␣-dependent.Conclusion. We report the first evidence that ERR␣ expression is regulated by IL-1␤ in COX-2-, cAMP-, and PKA-dependent pathways in OA chondrocytes. We confirmed that SOX9 is an ERR␣ target gene in human, as in rodent, chondrocytes and identified MMP-13 as a potential new target gene, which suggests that ERR␣ may both respond to the healing signal and contribute to extracellular degradation in OA cartilage.Osteoarthritis (OA) is a chronic disease characterized by slowly progressive destruction of the articular cartilage, combined with changes in the synovium and subchondral bone (1). Various estimates suggest that more than 40% of 70-year-old people currently have the disease, ranking OA as the most common arthritic condition. The prevalence and the pain and disability associated with progression of the disease have led to intense interest in defining markers for OA as well as the mechanisms underlying the disease.The cellular component of cartilage is the chondrocyte, and adult articular chondrocytes, although considered quiescent in normal cartilage, can respond to mechanical injury and biologic stimuli such as cytokines and growth factors. Interleukin-1␤ (IL-1␤) is a wellknown proinflammatory cytokine that is implicated in

show abstract

Estrogen modulates iodoacetate‐induced gene expression in bovine cartilage explants

Cited by 10 publications

References 42 publications

An Osteochondral Culture Model to Study Mechanisms Involved in Articular Cartilage Repair

An Osteochondral Culture Model to Study Mechanisms Involved in Articular Cartilage Repair

Common variations in estrogen-related genes are associated with severe large-joint osteoarthritis: a multicenter genetic and functional study

Estrogen receptor–related receptor α regulation by interleukin‐1β in prostaglandin E₂– and cAMP‐dependent pathways in osteoarthritic chondrocytes

Contact Info

Product

Resources

About

Estrogen modulates iodoacetate‐induced gene expression in bovine cartilage explants

Cited by 10 publications

References 42 publications

An Osteochondral Culture Model to Study Mechanisms Involved in Articular Cartilage Repair

An Osteochondral Culture Model to Study Mechanisms Involved in Articular Cartilage Repair

Common variations in estrogen-related genes are associated with severe large-joint osteoarthritis: a multicenter genetic and functional study

Estrogen receptor–related receptor α regulation by interleukin‐1β in prostaglandin E2– and cAMP‐dependent pathways in osteoarthritic chondrocytes

Contact Info

Product

Resources

About

Estrogen receptor–related receptor α regulation by interleukin‐1β in prostaglandin E₂– and cAMP‐dependent pathways in osteoarthritic chondrocytes