Epidemiology of Astrovirus, Norovirus and Sapovirus in Greek pig farms indicates high prevalence of Mamastrovirus suggesting the potential need for systematic surveillance

Abstract

Backround Astrovirus, Norovirus and Sapovirus exhibit a wide distribution in swine pig herds worldwide. However, the association of porcine Astrovirus (PAstV), porcine Norovirus (PoNoV) and porcine Sapovirus (PoSaV) with disease in pigs remains uncertain. In this study, we investigated the prevalence of PAstV, PoNoV and PoSaV in Greek pig farms using both conventional RT-PCR and SYBR-Green Real-time RT-PCR in an effort to compare the sensitivity of the two methods. We examined 1400 stool samples of asymptomatic pigs originating from 28 swine farms throughout Greece in pools of five. Results PAstV was detected in all 28 swine farms examined, with an overall prevalence of 267/280 positive pools (95.4%). Porcine Caliciviruses prevalence was found at 36 and 57 out of the 280 examined samples, by the conventional and SYBR-Green Real time RT-PCR, respectively. Sequencing and phylogenetic analysis of the positive samples revealed that the detected PAstV sequences are clustered within PAstV1, 3 and 4 lineages, with PAstV3 being the predominant haplotype (91.2%). Interestingly, sequencing of the Calicivirus positive samples demonstrated the presence of non-target viruses, i.e. Sapovirus, Kobuvirus and Sapelovirus sequences and one sequence highly similar to bat Astrovirus, while no Norovirus sequence was detected. Conclusions The high prevalence of PAstV in Greek pig farms poses a necessity for further investigation of the pathogenicity of this virus and its inclusion in surveillance programs in case that it proves to be important. To our knowledge, this is the first epidemiological study of these viruses in pig farms in Greece.

Swine Norovirus: Past, Present, and Future

“…Both types of studies present different sampling approaches, hampering a straightforward data comparison. Indeed, the information available, although increased over the years, is fragmented, and, most importantly, some studies represent single reports without any follow-up investigations (i.e., studies conducted in Belgium [ 44 ], Slovenia [ 34 ], Spain [ 31 ], Hungary [ 37 ] and Greece [ 45 ], Ethiopia [ 41 ], Taiwan [ 46 ], South Korea [ 32 ], Venezuela [ 47 ]). Only a few countries made more effort in detecting and characterising swine noroviruses, and two or more studies are available for each of these countries (i.e., Italy [ 21 , 22 , 28 , 48 ], USA [ 13 , 20 , 40 , 49 , 50 ], Canada [ 26 , 48 ], China [ 39 , 49 , 50 , 51 ], Japan [ 19 , 20 , 35 , 36 , 52 , 53 , 54 ], Germany [ 33 , 55 ], The Netherlands [ 55 , 56 ], Brazil [ 25 , 29 , 30 , 57 ]).…”

“…Swine norovirus was also reported in Oceania (New Zealand) more than ten years ago [ 60 ]. Thus far, eight European countries have detected the presence of swine noroviruses in their swine populations over a 21-year period between 1998 and 2019 [ 21 , 22 , 24 , 28 , 31 , 33 , 34 , 44 , 45 , 48 , 59 , 60 , 70 ]. Italy has generated six studies on swine noroviruses between 2008 and 2019, reporting the first detection in 2014 while investigating samples collected between 2006 and 2007 [ 24 ].…”

First report of canine Astrovirus and Sapovirus in Greece, hosting both asymptomatic and gastroenteritis symptomatic dogs

“…The Fast Gene IC Green One Step Mix kit was used for the reaction of the Sybr-Green Real time RT-PCR (Nippon Genetics). RT-PCR conditions and melt curve analysis was carried out as described in our previous work [ 49 ].…”

“…For the detection of canine Norovirus with the method of of SYBR-Green Real time RT-PCR, the primers F: GCTGGATGCGGTTCTCTGAC and R: TCATTAGACGCCATCTTCATTCAC were used [ 46 ] with RT-PCR reagents and conditions, and melt curve analysis exactly as in Stamelou et al (2022) [ 49 ]. The target sequence is the highly conserved region of the RdRp.…”

“…Fast Gene IC Green One Step Mix kit was used for the reaction of the Sybr-Green Real time RT-PCR (Nippon Genetics). The consentrations of the reagents and the conditions of the PCR are the same with those in Stamelou et al [ 49 ] for the detection of canine Norovirus.…”