Endothelial Cell Apoptosis Induces TGF-β Signaling-Dependent Host Endothelial–Mesenchymal Transition to Promote Transplant Arteriosclerosis

Abstract

Endothelial cells (ECs) apoptosis is an initial event in transplant arteriosclerosis (TA), resulting in allograft function loss. To elucidate the precise mechanisms of ECs apoptosis leading to neointimal smooth muscle cells (SMCs) accumulation during TA. We induced apoptosis in cultured ECs by overexpressing p53 through lentivirus-mediated transfection. ECs apoptosis induced the production of transforming growth factor (TGF)-b1 in both apoptotic and neighboring viable cells, leading to increased TGF-b1 in the culture media. Conditioned media from Ltv-p53-transfected ECs further promoted transition of cultured ECs to SMlike cells by activating TGF-b/Smad3, PI3K/Akt/mTOR, and MAPK/ERK signaling in a TGF-b-dependent manner. In transgenic rat aorta transplantation models, inhibition of ECs apoptosis in Bcl-xL +/+ knock-in rat aortic allografts significantly reduced TGF-b1 production both in allograft endothelia and in blood plasma, which in turn decreased accumulation of SM22aþ cells from transgenic recipient ECs originally marked with EGFP knock-in in neointima and alleviated TA. Systemic treatment with SIS3, AP23573, or PD98059 also prevented recipient ECs-originated SM-like cells accumulation and intima hyperplasia in aortic allografts. These data suggest that allograft EC apoptosis induced recipient endothelial-mesenchymal (smooth muscle) transition via TGF-b signaling, resulting in recipient EC-derived SMC accumulation as a major mechanism of vascular remodeling during TA.

Evodiamine Prevents Isoproterenol-Induced Cardiac Fibrosis by Regulating Endothelial-to-Mesenchymal Transition

“…TGF-β can activate Ras/Erk MAPK signaling and PI3K/Akt in the TGF-β/non-Smad pathway, which plays important roles in EndMT and EMT in a TGF-β-dependent manner [30][31][32]. The activated Erk can also induce the phosphorylation of Smad.…”

EOFAZ inhibits endothelial‑to‑mesenchymal transition through downregulation of KLF4

“…EndMT is induced by TGF-β1 in HUVECs. TGF-β1 is a powerful factor for induction of EndMT, although the effect depends of the treatment time and dose in different models (17). Relative VE-cadherin and α-SMA expression levels were determined by western blotting.…”

“…However, the role of EndMT and the mechanisms regulating cell phenotype adaption during vascular remodeling are poorly understood. Studies have reported that mouse and human endothelial cells are induced by transforming growth factor (TGF)-β1 to transform into SM-like cells in which the expression of α-smooth muscle actin (α-SMA) is upregulated (17,18). Under the synergistic action of TGF-β1 and the Wnt signaling pathway, EndMT may be induced.…”

Autophagy induces transforming growth factor‐β‐dependent epithelial‐mesenchymal transition in hepatocarcinoma cells through cAMP response element binding signalling

“…RNA expression was analysed by RT‐PCR using iQ SYBR Green Supermix in an iCycler Real‐Time PCR Detection System (Bio‐Rad). The following primer sequences were used: PDE4A: sense 5′‐AACTTTCCGCAGACGCCTT‐3′, antisense 5′‐ TCTGAGCGGTACAGGAAGGA‐3′, TGF‐β1: sense 5′‐AACTACTGCTTCAGCTCCAC‐3′, antisense 5′‐AGGACCTTGCTGTACTGTGT‐3′ . Expression was normalized to that of β‐actin.…”

“…The following primer sequences were used: PDE4A: sense 5′-AACTTTCCGCAGACGCCTT-3′, antisense 5′-TCTGAGCGGTACAGGAAGGA-3′, TGF-β1: sense 5′-AACTACTGCTTCAGCTCCAC-3′, antisense 5′-AGGACCTTGCTG-TACTGTGT-3′. 23 Expression was normalized to that of β-actin.…”