Emergence of two distinct variants of SARS-CoV-2 and an explosive second wave of COVID-19: the experience of a tertiary care hospital in Pune, India

Abstract

The emergence of novel variants of SARS-CoV-2 in several countries has been associated with increased transmissibility or reduced neutralization potential of antibodies against the Wuhan virus (wild type). From August 2021 onwards, India experienced a progressive decline in the number of active SARS-CoV-2 infections, indicative of a downward trend in the explosive second wave. This prospective study was conducted quarterly for one year (May 2020 to June 2021) at a tertiary care hospital in the city of Pune in western India. Receptor-binding domain (RBD, n = 319) and full genome (n = 20) sequences from viral-RNA-positive nasopharyngeal swabs of COVID-19 patients representing the first and second waves were used for analysis. No Brazilian, South African, or California variants were detected in this study. Until December 2020, only the wild-type strain was prevalent. Concurrent with the upsurge of the second wave in March 2021, 73% (33/45) of RBD sequences harboured L452R/E484Q mutations characteristic of the Kappa variant. In April 2021, co-circulation of Kappa (37%) and Delta (L452R/T478K, 59%) variants was recorded. During May and June 2021, the Delta variant became the predominant circulating variant, and this coincided with a significant decline in the number of COVID-19 cases. Of the 20 full genome sequences, six isolates each exhibited signature mutations of the Kappa and Delta variant. With several states witnessing a reduction in the number of COVID-19 cases, continuous monitoring of newer mutations and assessment of their effect on virus transmissibility and their impact on vaccinated or previously exposed individuals is necessary. Supplementary Information The online version contains supplementary material available at 10.1007/s00705-021-05320-7.

SARS-CoV-2 breakthrough infections during the second wave of COVID-19 at Pune, India

“…Previously, we showed the emergence of kappa variant during the earlier phase of the second wave followed by co-circulation with delta variant and subsequent complete replacement by the delta variant ( 21 ), Therefore, we compared detection rates of the variants in vaccinated and non-vaccinated patients infected during different months ( Table 3 ). Except for the kappa variant, the presence of other variants was similar during the study months.…”

“…A larger sample size will be required to identify further subgroups with or without benefits. As we were monitoring variants during the pandemic in the same setting (21), we could compare infecting variants during the second in relation to vaccination status (Table 2). The variant of concerns (VOCs) circulating in Brazil and South Africa were not detected with only 1 non-vaccinated patient infected with the UK strain.…”

“…The full genomes of SARS-CoV-2 from vaccinated ( n = 2, GenBank Acc No- MZ574051 and MZ574056 ) and non-vaccinated ( n = 4, MZ574052, MZ574053, MZ574054 and MZ574055) patients were obtained as described earlier ( 21 ). In addition, full genome sequences deposited in GISAID database ( https://gisaid.org/ ) were also used.…”

“…The Nested PCR approach was used for the amplification of the RBD region of SARS-CoV-2. The 1 st PCR was set using Forward primer (5 ′ GTAATGATCCATTTTTGGGTG 3 ′ ) of the spike region (21,989) and Reverse primer (5 ′ GTCTGAGTCTGATAACTAGCGC 3 ′ ) of the spike region (23,574) whereas nested PCR was set using forward RBD-F (5 ′ AATATTACAAACTTGTGCCCT 3 ′ ) and reverse RBD-R (5 ′ AACAGTTGCTGGTGCATGTA 3 ′ ) primers. PCR products of Nested PCR positive samples (∼600 bp) were gel purified and sequenced from both the ends using Big Dye terminator cycle sequencing kit (Thermofisher Scientific, MA, USA).…”

Time dependent decline of neutralizing antibody titers in COVID-19 patients from Pune, India and evidence of reinfection

“…At this time, Pune was already experiencing second wave of COVID-19. The month of March was predominated by the kappa variant (L452R/E484Q in the Receptor Binding Domain (RBD) of SARS-CoV-2 while from April onwards delta variant was most prevalent [ 20 ]. This indicates reinfection of individuals infected during the first wave by the Wuhan-like virus by the two variant viruses causing the second wave.…”