Efficient Synthesis of 2’‐O‐Methoxyethyl Oligonucleotide‐Cationic Peptide Conjugates

Abstract

Single‐stranded phosphorothioate (PS) oligonucleotide drugs have shown potential for the treatment of several rare diseases. However, a barrier to their widespread use is that they exhibit activity in only a narrow range of tissues. One way to circumvent this constraint is to conjugate them to cationic cell‐penetrating peptides (CPPs). Although there are several examples of morpholino and peptide nucleic acids conjugated with CPPs, there are noticeably few examples of PS oligonucleotide‐CPP conjugates. This is surprising given that PS oligonucleotides presently represent the largest class of approved RNA‐based drugs, including Nusinersen, that bears the 2’‐O‐methoxyethyl (MOE)‐chemistry. In this work, we report a method for in‐solution conjugation of cationic, hydrophobic peptides or human serum albumin to a 22‐nucleotide MOE‐PS oligonucleotide. Conjugates were obtained in high yields and purities. Our findings pave the way for their large‐scale synthesis and testing in vivo.

Peptide Conjugates of a 2′-O-Methoxyethyl Phosphorothioate Splice-Switching Oligonucleotide Show Increased Entrapment in Endosomes

“…As model sequences, we selected SSOs previously developed to treat EPP. , To quantify the oligonucleotides in cells and subcellular compartments following free uptake, we employed CL-qPCR, ,, a technique we established as superior to Splint ligation-qPCR at detecting an ASO with MOE PS chemistry (Figure C,D). Using CL-qPCR, we detected approximately 50,000 to 200,000 ASO molecules per nucleus following free uptake at low micromolar concentrations for 24 h (Table S2), which is consistent with previous reports. , Then, we covalently conjugated different NLS peptides to a lead MOE PS oligonucleotide using thiol–maleimide chemistry. , Using CL-qPCR, we identified one conjugate with better nuclear accumulation relative to the parent SSO (Figures E, E). However, in contrast to the parent, unconjugated SSO, the conjugates were inactive at splice correction under free uptake conditions in vitro .…”

“…As a lead oligonucleotide, we selected the c.315-48C-targeting MOE PS ON5, as this molecule displayed a higher RNA target-binding affinity (Figure C) and trended toward higher nuclear accumulation (Figures E, S10, Table S2) relative to the DNA/LNA PS ON2. For conjugation, we prepared a 5′-capped-maleimide-modified ON5 using a commercially available building block as previously described . Conjugate masses and purities are listed in Figure B.…”

“…Collected fractions were pooled, vacuum-concentrated, and diluted in ultrapure water. The absorbance at 260 nm of each conjugate was measured as described above, and concentrations were calculated as previously described . Purity was assessed by LC–MS as described above.…”

“…UV melting was performed as previously described . Briefly, oligonucleotides and conjugates were prepared at 2 μM in 100 mM NaCl, 10 mM phosphate, and 0.1 mM Na 2 EDTA, pH 7.0, in the presence of 2 μM RNA target with the sequence 5′-r­(AGAAAACAUUUCUCAGGCUGCU)-3′ (Microsynth AG, Balgach, Switzerland).…”

“…UV melting was performed as previously described. 47 Briefly, oligonucleotides and conjugates were prepared at 2 μM in 100 mM NaCl, 10 mM phosphate, and 0.1 mM Na 2 EDTA, pH 7.0, in the presence of 2 μM RNA target w i t h t h e s e q u e n c e 5 ′ -r -(AGAAAACAUUUCUCAGGCUGCU)-3′ (Microsynth AG, Balgach, Switzerland). Absorbance at 260 nm was measured over the temperature range of 20 to 90 °C on a Cary 300 spectrophotometer (Varian) using a heating rate of 0.5 °C/min and a data collection interval of 0.5 °C.…”